ID: 1123110472

View in Genome Browser
Species Human (GRCh38)
Location 14:105864763-105864785
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123110460_1123110472 -1 Left 1123110460 14:105864741-105864763 CCTGTCCCCAGCCACACAGACCC No data
Right 1123110472 14:105864763-105864785 CCCGGGCTGAGACCCAGGCAGGG No data
1123110459_1123110472 0 Left 1123110459 14:105864740-105864762 CCCTGTCCCCAGCCACACAGACC No data
Right 1123110472 14:105864763-105864785 CCCGGGCTGAGACCCAGGCAGGG No data
1123110465_1123110472 -8 Left 1123110465 14:105864748-105864770 CCAGCCACACAGACCCCCGGGCT No data
Right 1123110472 14:105864763-105864785 CCCGGGCTGAGACCCAGGCAGGG No data
1123110464_1123110472 -7 Left 1123110464 14:105864747-105864769 CCCAGCCACACAGACCCCCGGGC No data
Right 1123110472 14:105864763-105864785 CCCGGGCTGAGACCCAGGCAGGG No data
1123110455_1123110472 29 Left 1123110455 14:105864711-105864733 CCCAAGCACAGAGCAGAGGCAGC No data
Right 1123110472 14:105864763-105864785 CCCGGGCTGAGACCCAGGCAGGG No data
1123110458_1123110472 7 Left 1123110458 14:105864733-105864755 CCGGCGTCCCTGTCCCCAGCCAC No data
Right 1123110472 14:105864763-105864785 CCCGGGCTGAGACCCAGGCAGGG No data
1123110462_1123110472 -6 Left 1123110462 14:105864746-105864768 CCCCAGCCACACAGACCCCCGGG No data
Right 1123110472 14:105864763-105864785 CCCGGGCTGAGACCCAGGCAGGG No data
1123110456_1123110472 28 Left 1123110456 14:105864712-105864734 CCAAGCACAGAGCAGAGGCAGCC No data
Right 1123110472 14:105864763-105864785 CCCGGGCTGAGACCCAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123110472 Original CRISPR CCCGGGCTGAGACCCAGGCA GGG Intergenic