ID: 1123110473

View in Genome Browser
Species Human (GRCh38)
Location 14:105864764-105864786
Sequence TCCCTGCCTGGGTCTCAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123110473_1123110479 -6 Left 1123110473 14:105864764-105864786 CCGGGCTGAGACCCAGGCAGGGA No data
Right 1123110479 14:105864781-105864803 CAGGGAGGGGTGACGTTCCCAGG No data
1123110473_1123110483 8 Left 1123110473 14:105864764-105864786 CCGGGCTGAGACCCAGGCAGGGA No data
Right 1123110483 14:105864795-105864817 GTTCCCAGGGAGACGGTGGCCGG No data
1123110473_1123110487 18 Left 1123110473 14:105864764-105864786 CCGGGCTGAGACCCAGGCAGGGA No data
Right 1123110487 14:105864805-105864827 AGACGGTGGCCGGGCTGCCCTGG No data
1123110473_1123110484 9 Left 1123110473 14:105864764-105864786 CCGGGCTGAGACCCAGGCAGGGA No data
Right 1123110484 14:105864796-105864818 TTCCCAGGGAGACGGTGGCCGGG No data
1123110473_1123110481 1 Left 1123110473 14:105864764-105864786 CCGGGCTGAGACCCAGGCAGGGA No data
Right 1123110481 14:105864788-105864810 GGGTGACGTTCCCAGGGAGACGG No data
1123110473_1123110482 4 Left 1123110473 14:105864764-105864786 CCGGGCTGAGACCCAGGCAGGGA No data
Right 1123110482 14:105864791-105864813 TGACGTTCCCAGGGAGACGGTGG No data
1123110473_1123110480 -5 Left 1123110473 14:105864764-105864786 CCGGGCTGAGACCCAGGCAGGGA No data
Right 1123110480 14:105864782-105864804 AGGGAGGGGTGACGTTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123110473 Original CRISPR TCCCTGCCTGGGTCTCAGCC CGG (reversed) Intergenic