ID: 1123110474

View in Genome Browser
Species Human (GRCh38)
Location 14:105864766-105864788
Sequence GGGCTGAGACCCAGGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123110458_1123110474 10 Left 1123110458 14:105864733-105864755 CCGGCGTCCCTGTCCCCAGCCAC No data
Right 1123110474 14:105864766-105864788 GGGCTGAGACCCAGGCAGGGAGG No data
1123110462_1123110474 -3 Left 1123110462 14:105864746-105864768 CCCCAGCCACACAGACCCCCGGG No data
Right 1123110474 14:105864766-105864788 GGGCTGAGACCCAGGCAGGGAGG No data
1123110466_1123110474 -9 Left 1123110466 14:105864752-105864774 CCACACAGACCCCCGGGCTGAGA No data
Right 1123110474 14:105864766-105864788 GGGCTGAGACCCAGGCAGGGAGG No data
1123110464_1123110474 -4 Left 1123110464 14:105864747-105864769 CCCAGCCACACAGACCCCCGGGC No data
Right 1123110474 14:105864766-105864788 GGGCTGAGACCCAGGCAGGGAGG No data
1123110460_1123110474 2 Left 1123110460 14:105864741-105864763 CCTGTCCCCAGCCACACAGACCC No data
Right 1123110474 14:105864766-105864788 GGGCTGAGACCCAGGCAGGGAGG No data
1123110465_1123110474 -5 Left 1123110465 14:105864748-105864770 CCAGCCACACAGACCCCCGGGCT No data
Right 1123110474 14:105864766-105864788 GGGCTGAGACCCAGGCAGGGAGG No data
1123110459_1123110474 3 Left 1123110459 14:105864740-105864762 CCCTGTCCCCAGCCACACAGACC No data
Right 1123110474 14:105864766-105864788 GGGCTGAGACCCAGGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123110474 Original CRISPR GGGCTGAGACCCAGGCAGGG AGG Intergenic