ID: 1123110479

View in Genome Browser
Species Human (GRCh38)
Location 14:105864781-105864803
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123110459_1123110479 18 Left 1123110459 14:105864740-105864762 CCCTGTCCCCAGCCACACAGACC No data
Right 1123110479 14:105864781-105864803 CAGGGAGGGGTGACGTTCCCAGG No data
1123110458_1123110479 25 Left 1123110458 14:105864733-105864755 CCGGCGTCCCTGTCCCCAGCCAC No data
Right 1123110479 14:105864781-105864803 CAGGGAGGGGTGACGTTCCCAGG No data
1123110473_1123110479 -6 Left 1123110473 14:105864764-105864786 CCGGGCTGAGACCCAGGCAGGGA No data
Right 1123110479 14:105864781-105864803 CAGGGAGGGGTGACGTTCCCAGG No data
1123110460_1123110479 17 Left 1123110460 14:105864741-105864763 CCTGTCCCCAGCCACACAGACCC No data
Right 1123110479 14:105864781-105864803 CAGGGAGGGGTGACGTTCCCAGG No data
1123110468_1123110479 -3 Left 1123110468 14:105864761-105864783 CCCCCGGGCTGAGACCCAGGCAG No data
Right 1123110479 14:105864781-105864803 CAGGGAGGGGTGACGTTCCCAGG No data
1123110465_1123110479 10 Left 1123110465 14:105864748-105864770 CCAGCCACACAGACCCCCGGGCT No data
Right 1123110479 14:105864781-105864803 CAGGGAGGGGTGACGTTCCCAGG No data
1123110462_1123110479 12 Left 1123110462 14:105864746-105864768 CCCCAGCCACACAGACCCCCGGG No data
Right 1123110479 14:105864781-105864803 CAGGGAGGGGTGACGTTCCCAGG No data
1123110466_1123110479 6 Left 1123110466 14:105864752-105864774 CCACACAGACCCCCGGGCTGAGA No data
Right 1123110479 14:105864781-105864803 CAGGGAGGGGTGACGTTCCCAGG No data
1123110469_1123110479 -4 Left 1123110469 14:105864762-105864784 CCCCGGGCTGAGACCCAGGCAGG No data
Right 1123110479 14:105864781-105864803 CAGGGAGGGGTGACGTTCCCAGG No data
1123110464_1123110479 11 Left 1123110464 14:105864747-105864769 CCCAGCCACACAGACCCCCGGGC No data
Right 1123110479 14:105864781-105864803 CAGGGAGGGGTGACGTTCCCAGG No data
1123110471_1123110479 -5 Left 1123110471 14:105864763-105864785 CCCGGGCTGAGACCCAGGCAGGG No data
Right 1123110479 14:105864781-105864803 CAGGGAGGGGTGACGTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123110479 Original CRISPR CAGGGAGGGGTGACGTTCCC AGG Intergenic