ID: 1123110487

View in Genome Browser
Species Human (GRCh38)
Location 14:105864805-105864827
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123110466_1123110487 30 Left 1123110466 14:105864752-105864774 CCACACAGACCCCCGGGCTGAGA No data
Right 1123110487 14:105864805-105864827 AGACGGTGGCCGGGCTGCCCTGG No data
1123110473_1123110487 18 Left 1123110473 14:105864764-105864786 CCGGGCTGAGACCCAGGCAGGGA No data
Right 1123110487 14:105864805-105864827 AGACGGTGGCCGGGCTGCCCTGG No data
1123110478_1123110487 6 Left 1123110478 14:105864776-105864798 CCAGGCAGGGAGGGGTGACGTTC No data
Right 1123110487 14:105864805-105864827 AGACGGTGGCCGGGCTGCCCTGG No data
1123110471_1123110487 19 Left 1123110471 14:105864763-105864785 CCCGGGCTGAGACCCAGGCAGGG No data
Right 1123110487 14:105864805-105864827 AGACGGTGGCCGGGCTGCCCTGG No data
1123110468_1123110487 21 Left 1123110468 14:105864761-105864783 CCCCCGGGCTGAGACCCAGGCAG No data
Right 1123110487 14:105864805-105864827 AGACGGTGGCCGGGCTGCCCTGG No data
1123110477_1123110487 7 Left 1123110477 14:105864775-105864797 CCCAGGCAGGGAGGGGTGACGTT No data
Right 1123110487 14:105864805-105864827 AGACGGTGGCCGGGCTGCCCTGG No data
1123110469_1123110487 20 Left 1123110469 14:105864762-105864784 CCCCGGGCTGAGACCCAGGCAGG No data
Right 1123110487 14:105864805-105864827 AGACGGTGGCCGGGCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123110487 Original CRISPR AGACGGTGGCCGGGCTGCCC TGG Intergenic