ID: 1123111479

View in Genome Browser
Species Human (GRCh38)
Location 14:105869580-105869602
Sequence CAACTGTTCTTGAAGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123111479_1123111483 24 Left 1123111479 14:105869580-105869602 CCTTTTTTCTTCAAGAACAGTTG No data
Right 1123111483 14:105869627-105869649 CACTACTTCTTTCCCCCTTAAGG No data
1123111479_1123111481 -5 Left 1123111479 14:105869580-105869602 CCTTTTTTCTTCAAGAACAGTTG No data
Right 1123111481 14:105869598-105869620 AGTTGGCTGTATATAGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123111479 Original CRISPR CAACTGTTCTTGAAGAAAAA AGG (reversed) Intergenic
No off target data available for this crispr