ID: 1123111968

View in Genome Browser
Species Human (GRCh38)
Location 14:105876199-105876221
Sequence GTTCTGAGCCTCCTGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123111962_1123111968 16 Left 1123111962 14:105876160-105876182 CCTTACTTTCTCCCAAACAAATG 0: 77
1: 169
2: 279
3: 361
4: 618
Right 1123111968 14:105876199-105876221 GTTCTGAGCCTCCTGGAGATGGG No data
1123111964_1123111968 5 Left 1123111964 14:105876171-105876193 CCCAAACAAATGGAGTCTCTCTC 0: 56
1: 147
2: 241
3: 343
4: 543
Right 1123111968 14:105876199-105876221 GTTCTGAGCCTCCTGGAGATGGG No data
1123111965_1123111968 4 Left 1123111965 14:105876172-105876194 CCAAACAAATGGAGTCTCTCTCT 0: 68
1: 148
2: 267
3: 332
4: 555
Right 1123111968 14:105876199-105876221 GTTCTGAGCCTCCTGGAGATGGG No data
1123111961_1123111968 17 Left 1123111961 14:105876159-105876181 CCCTTACTTTCTCCCAAACAAAT 0: 86
1: 215
2: 377
3: 352
4: 665
Right 1123111968 14:105876199-105876221 GTTCTGAGCCTCCTGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123111968 Original CRISPR GTTCTGAGCCTCCTGGAGAT GGG Intergenic
No off target data available for this crispr