ID: 1123113157

View in Genome Browser
Species Human (GRCh38)
Location 14:105882337-105882359
Sequence CAGGCTGCGGGGAAGGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123113157_1123113177 26 Left 1123113157 14:105882337-105882359 CCCTGGTCCTTCCCCGCAGCCTG No data
Right 1123113177 14:105882386-105882408 GACCATACCCTCTAGGAGGCTGG No data
1123113157_1123113176 22 Left 1123113157 14:105882337-105882359 CCCTGGTCCTTCCCCGCAGCCTG No data
Right 1123113176 14:105882382-105882404 GGTGGACCATACCCTCTAGGAGG No data
1123113157_1123113167 -4 Left 1123113157 14:105882337-105882359 CCCTGGTCCTTCCCCGCAGCCTG No data
Right 1123113167 14:105882356-105882378 CCTGCCACGGTGGGAGCCCCAGG No data
1123113157_1123113175 19 Left 1123113157 14:105882337-105882359 CCCTGGTCCTTCCCCGCAGCCTG No data
Right 1123113175 14:105882379-105882401 CAGGGTGGACCATACCCTCTAGG No data
1123113157_1123113170 1 Left 1123113157 14:105882337-105882359 CCCTGGTCCTTCCCCGCAGCCTG No data
Right 1123113170 14:105882361-105882383 CACGGTGGGAGCCCCAGGCAGGG No data
1123113157_1123113171 4 Left 1123113157 14:105882337-105882359 CCCTGGTCCTTCCCCGCAGCCTG No data
Right 1123113171 14:105882364-105882386 GGTGGGAGCCCCAGGCAGGGTGG No data
1123113157_1123113169 0 Left 1123113157 14:105882337-105882359 CCCTGGTCCTTCCCCGCAGCCTG No data
Right 1123113169 14:105882360-105882382 CCACGGTGGGAGCCCCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123113157 Original CRISPR CAGGCTGCGGGGAAGGACCA GGG (reversed) Intergenic
No off target data available for this crispr