ID: 1123113396

View in Genome Browser
Species Human (GRCh38)
Location 14:105883192-105883214
Sequence GGCCAAAGGCTGGGCCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123113396_1123113409 17 Left 1123113396 14:105883192-105883214 CCTGGCAGGCCCAGCCTTTGGCC No data
Right 1123113409 14:105883232-105883254 GGCCTGGGAAGCCGAGCTGTTGG No data
1123113396_1123113411 20 Left 1123113396 14:105883192-105883214 CCTGGCAGGCCCAGCCTTTGGCC No data
Right 1123113411 14:105883235-105883257 CTGGGAAGCCGAGCTGTTGGTGG No data
1123113396_1123113403 -5 Left 1123113396 14:105883192-105883214 CCTGGCAGGCCCAGCCTTTGGCC No data
Right 1123113403 14:105883210-105883232 TGGCCTTCCTTGGAGGGATGAGG No data
1123113396_1123113408 2 Left 1123113396 14:105883192-105883214 CCTGGCAGGCCCAGCCTTTGGCC No data
Right 1123113408 14:105883217-105883239 CCTTGGAGGGATGAGGGCCTGGG No data
1123113396_1123113412 26 Left 1123113396 14:105883192-105883214 CCTGGCAGGCCCAGCCTTTGGCC No data
Right 1123113412 14:105883241-105883263 AGCCGAGCTGTTGGTGGCGCTGG No data
1123113396_1123113406 1 Left 1123113396 14:105883192-105883214 CCTGGCAGGCCCAGCCTTTGGCC No data
Right 1123113406 14:105883216-105883238 TCCTTGGAGGGATGAGGGCCTGG No data
1123113396_1123113413 27 Left 1123113396 14:105883192-105883214 CCTGGCAGGCCCAGCCTTTGGCC No data
Right 1123113413 14:105883242-105883264 GCCGAGCTGTTGGTGGCGCTGGG No data
1123113396_1123113404 -4 Left 1123113396 14:105883192-105883214 CCTGGCAGGCCCAGCCTTTGGCC No data
Right 1123113404 14:105883211-105883233 GGCCTTCCTTGGAGGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123113396 Original CRISPR GGCCAAAGGCTGGGCCTGCC AGG (reversed) Intergenic
No off target data available for this crispr