ID: 1123114501

View in Genome Browser
Species Human (GRCh38)
Location 14:105888488-105888510
Sequence GCACCCACTCCTGGGACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123114501_1123114508 2 Left 1123114501 14:105888488-105888510 CCCTCAGTCCCAGGAGTGGGTGC No data
Right 1123114508 14:105888513-105888535 TTGCAGTAGGGCTTTAGGAATGG No data
1123114501_1123114510 4 Left 1123114501 14:105888488-105888510 CCCTCAGTCCCAGGAGTGGGTGC No data
Right 1123114510 14:105888515-105888537 GCAGTAGGGCTTTAGGAATGGGG No data
1123114501_1123114507 -3 Left 1123114501 14:105888488-105888510 CCCTCAGTCCCAGGAGTGGGTGC No data
Right 1123114507 14:105888508-105888530 TGCGTTTGCAGTAGGGCTTTAGG No data
1123114501_1123114509 3 Left 1123114501 14:105888488-105888510 CCCTCAGTCCCAGGAGTGGGTGC No data
Right 1123114509 14:105888514-105888536 TGCAGTAGGGCTTTAGGAATGGG No data
1123114501_1123114512 19 Left 1123114501 14:105888488-105888510 CCCTCAGTCCCAGGAGTGGGTGC No data
Right 1123114512 14:105888530-105888552 GAATGGGGTTGTGTCACTGTGGG No data
1123114501_1123114506 -10 Left 1123114501 14:105888488-105888510 CCCTCAGTCCCAGGAGTGGGTGC No data
Right 1123114506 14:105888501-105888523 GAGTGGGTGCGTTTGCAGTAGGG No data
1123114501_1123114511 18 Left 1123114501 14:105888488-105888510 CCCTCAGTCCCAGGAGTGGGTGC No data
Right 1123114511 14:105888529-105888551 GGAATGGGGTTGTGTCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123114501 Original CRISPR GCACCCACTCCTGGGACTGA GGG (reversed) Intergenic
No off target data available for this crispr