ID: 1123115371

View in Genome Browser
Species Human (GRCh38)
Location 14:105892012-105892034
Sequence CACCCCGAAGAAGTCCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123115371_1123115376 0 Left 1123115371 14:105892012-105892034 CCTGGCAGGACTTCTTCGGGGTG No data
Right 1123115376 14:105892035-105892057 CTGGGTCTGTCCTCTGTGGGAGG No data
1123115371_1123115378 2 Left 1123115371 14:105892012-105892034 CCTGGCAGGACTTCTTCGGGGTG No data
Right 1123115378 14:105892037-105892059 GGGTCTGTCCTCTGTGGGAGGGG No data
1123115371_1123115381 20 Left 1123115371 14:105892012-105892034 CCTGGCAGGACTTCTTCGGGGTG No data
Right 1123115381 14:105892055-105892077 AGGGGCTGCTACCCAGGCCCAGG No data
1123115371_1123115375 -3 Left 1123115371 14:105892012-105892034 CCTGGCAGGACTTCTTCGGGGTG No data
Right 1123115375 14:105892032-105892054 GTGCTGGGTCTGTCCTCTGTGGG No data
1123115371_1123115374 -4 Left 1123115371 14:105892012-105892034 CCTGGCAGGACTTCTTCGGGGTG No data
Right 1123115374 14:105892031-105892053 GGTGCTGGGTCTGTCCTCTGTGG No data
1123115371_1123115380 14 Left 1123115371 14:105892012-105892034 CCTGGCAGGACTTCTTCGGGGTG No data
Right 1123115380 14:105892049-105892071 TGTGGGAGGGGCTGCTACCCAGG No data
1123115371_1123115382 30 Left 1123115371 14:105892012-105892034 CCTGGCAGGACTTCTTCGGGGTG No data
Right 1123115382 14:105892065-105892087 ACCCAGGCCCAGGACTGCAGTGG No data
1123115371_1123115377 1 Left 1123115371 14:105892012-105892034 CCTGGCAGGACTTCTTCGGGGTG No data
Right 1123115377 14:105892036-105892058 TGGGTCTGTCCTCTGTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123115371 Original CRISPR CACCCCGAAGAAGTCCTGCC AGG (reversed) Intergenic