ID: 1123115379

View in Genome Browser
Species Human (GRCh38)
Location 14:105892045-105892067
Sequence GGTAGCAGCCCCTCCCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123115379_1123115391 13 Left 1123115379 14:105892045-105892067 CCTCTGTGGGAGGGGCTGCTACC No data
Right 1123115391 14:105892081-105892103 GCAGTGGAGGGCTCACTGAGGGG No data
1123115379_1123115392 20 Left 1123115379 14:105892045-105892067 CCTCTGTGGGAGGGGCTGCTACC No data
Right 1123115392 14:105892088-105892110 AGGGCTCACTGAGGGGCTTTTGG No data
1123115379_1123115389 11 Left 1123115379 14:105892045-105892067 CCTCTGTGGGAGGGGCTGCTACC No data
Right 1123115389 14:105892079-105892101 CTGCAGTGGAGGGCTCACTGAGG No data
1123115379_1123115394 26 Left 1123115379 14:105892045-105892067 CCTCTGTGGGAGGGGCTGCTACC No data
Right 1123115394 14:105892094-105892116 CACTGAGGGGCTTTTGGGTCTGG No data
1123115379_1123115382 -3 Left 1123115379 14:105892045-105892067 CCTCTGTGGGAGGGGCTGCTACC No data
Right 1123115382 14:105892065-105892087 ACCCAGGCCCAGGACTGCAGTGG No data
1123115379_1123115393 21 Left 1123115379 14:105892045-105892067 CCTCTGTGGGAGGGGCTGCTACC No data
Right 1123115393 14:105892089-105892111 GGGCTCACTGAGGGGCTTTTGGG No data
1123115379_1123115386 1 Left 1123115379 14:105892045-105892067 CCTCTGTGGGAGGGGCTGCTACC No data
Right 1123115386 14:105892069-105892091 AGGCCCAGGACTGCAGTGGAGGG No data
1123115379_1123115390 12 Left 1123115379 14:105892045-105892067 CCTCTGTGGGAGGGGCTGCTACC No data
Right 1123115390 14:105892080-105892102 TGCAGTGGAGGGCTCACTGAGGG No data
1123115379_1123115385 0 Left 1123115379 14:105892045-105892067 CCTCTGTGGGAGGGGCTGCTACC No data
Right 1123115385 14:105892068-105892090 CAGGCCCAGGACTGCAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123115379 Original CRISPR GGTAGCAGCCCCTCCCACAG AGG (reversed) Intergenic