ID: 1123115382

View in Genome Browser
Species Human (GRCh38)
Location 14:105892065-105892087
Sequence ACCCAGGCCCAGGACTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123115371_1123115382 30 Left 1123115371 14:105892012-105892034 CCTGGCAGGACTTCTTCGGGGTG No data
Right 1123115382 14:105892065-105892087 ACCCAGGCCCAGGACTGCAGTGG No data
1123115379_1123115382 -3 Left 1123115379 14:105892045-105892067 CCTCTGTGGGAGGGGCTGCTACC No data
Right 1123115382 14:105892065-105892087 ACCCAGGCCCAGGACTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123115382 Original CRISPR ACCCAGGCCCAGGACTGCAG TGG Intergenic