ID: 1123115383

View in Genome Browser
Species Human (GRCh38)
Location 14:105892066-105892088
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123115383_1123115397 22 Left 1123115383 14:105892066-105892088 CCCAGGCCCAGGACTGCAGTGGA No data
Right 1123115397 14:105892111-105892133 GTCTGGCCTGAGCCGCTGTGGGG No data
1123115383_1123115389 -10 Left 1123115383 14:105892066-105892088 CCCAGGCCCAGGACTGCAGTGGA No data
Right 1123115389 14:105892079-105892101 CTGCAGTGGAGGGCTCACTGAGG No data
1123115383_1123115392 -1 Left 1123115383 14:105892066-105892088 CCCAGGCCCAGGACTGCAGTGGA No data
Right 1123115392 14:105892088-105892110 AGGGCTCACTGAGGGGCTTTTGG No data
1123115383_1123115393 0 Left 1123115383 14:105892066-105892088 CCCAGGCCCAGGACTGCAGTGGA No data
Right 1123115393 14:105892089-105892111 GGGCTCACTGAGGGGCTTTTGGG No data
1123115383_1123115390 -9 Left 1123115383 14:105892066-105892088 CCCAGGCCCAGGACTGCAGTGGA No data
Right 1123115390 14:105892080-105892102 TGCAGTGGAGGGCTCACTGAGGG No data
1123115383_1123115394 5 Left 1123115383 14:105892066-105892088 CCCAGGCCCAGGACTGCAGTGGA No data
Right 1123115394 14:105892094-105892116 CACTGAGGGGCTTTTGGGTCTGG No data
1123115383_1123115391 -8 Left 1123115383 14:105892066-105892088 CCCAGGCCCAGGACTGCAGTGGA No data
Right 1123115391 14:105892081-105892103 GCAGTGGAGGGCTCACTGAGGGG No data
1123115383_1123115395 20 Left 1123115383 14:105892066-105892088 CCCAGGCCCAGGACTGCAGTGGA No data
Right 1123115395 14:105892109-105892131 GGGTCTGGCCTGAGCCGCTGTGG No data
1123115383_1123115396 21 Left 1123115383 14:105892066-105892088 CCCAGGCCCAGGACTGCAGTGGA No data
Right 1123115396 14:105892110-105892132 GGTCTGGCCTGAGCCGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123115383 Original CRISPR TCCACTGCAGTCCTGGGCCT GGG (reversed) Intergenic