ID: 1123115386

View in Genome Browser
Species Human (GRCh38)
Location 14:105892069-105892091
Sequence AGGCCCAGGACTGCAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123115379_1123115386 1 Left 1123115379 14:105892045-105892067 CCTCTGTGGGAGGGGCTGCTACC No data
Right 1123115386 14:105892069-105892091 AGGCCCAGGACTGCAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123115386 Original CRISPR AGGCCCAGGACTGCAGTGGA GGG Intergenic