ID: 1123115388

View in Genome Browser
Species Human (GRCh38)
Location 14:105892073-105892095
Sequence TGAGCCCTCCACTGCAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123115388_1123115395 13 Left 1123115388 14:105892073-105892095 CCAGGACTGCAGTGGAGGGCTCA No data
Right 1123115395 14:105892109-105892131 GGGTCTGGCCTGAGCCGCTGTGG No data
1123115388_1123115394 -2 Left 1123115388 14:105892073-105892095 CCAGGACTGCAGTGGAGGGCTCA No data
Right 1123115394 14:105892094-105892116 CACTGAGGGGCTTTTGGGTCTGG No data
1123115388_1123115396 14 Left 1123115388 14:105892073-105892095 CCAGGACTGCAGTGGAGGGCTCA No data
Right 1123115396 14:105892110-105892132 GGTCTGGCCTGAGCCGCTGTGGG No data
1123115388_1123115393 -7 Left 1123115388 14:105892073-105892095 CCAGGACTGCAGTGGAGGGCTCA No data
Right 1123115393 14:105892089-105892111 GGGCTCACTGAGGGGCTTTTGGG No data
1123115388_1123115392 -8 Left 1123115388 14:105892073-105892095 CCAGGACTGCAGTGGAGGGCTCA No data
Right 1123115392 14:105892088-105892110 AGGGCTCACTGAGGGGCTTTTGG No data
1123115388_1123115397 15 Left 1123115388 14:105892073-105892095 CCAGGACTGCAGTGGAGGGCTCA No data
Right 1123115397 14:105892111-105892133 GTCTGGCCTGAGCCGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123115388 Original CRISPR TGAGCCCTCCACTGCAGTCC TGG (reversed) Intergenic