ID: 1123115390

View in Genome Browser
Species Human (GRCh38)
Location 14:105892080-105892102
Sequence TGCAGTGGAGGGCTCACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123115383_1123115390 -9 Left 1123115383 14:105892066-105892088 CCCAGGCCCAGGACTGCAGTGGA No data
Right 1123115390 14:105892080-105892102 TGCAGTGGAGGGCTCACTGAGGG No data
1123115384_1123115390 -10 Left 1123115384 14:105892067-105892089 CCAGGCCCAGGACTGCAGTGGAG No data
Right 1123115390 14:105892080-105892102 TGCAGTGGAGGGCTCACTGAGGG No data
1123115379_1123115390 12 Left 1123115379 14:105892045-105892067 CCTCTGTGGGAGGGGCTGCTACC No data
Right 1123115390 14:105892080-105892102 TGCAGTGGAGGGCTCACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123115390 Original CRISPR TGCAGTGGAGGGCTCACTGA GGG Intergenic