ID: 1123115394

View in Genome Browser
Species Human (GRCh38)
Location 14:105892094-105892116
Sequence CACTGAGGGGCTTTTGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123115388_1123115394 -2 Left 1123115388 14:105892073-105892095 CCAGGACTGCAGTGGAGGGCTCA No data
Right 1123115394 14:105892094-105892116 CACTGAGGGGCTTTTGGGTCTGG No data
1123115384_1123115394 4 Left 1123115384 14:105892067-105892089 CCAGGCCCAGGACTGCAGTGGAG No data
Right 1123115394 14:105892094-105892116 CACTGAGGGGCTTTTGGGTCTGG No data
1123115383_1123115394 5 Left 1123115383 14:105892066-105892088 CCCAGGCCCAGGACTGCAGTGGA No data
Right 1123115394 14:105892094-105892116 CACTGAGGGGCTTTTGGGTCTGG No data
1123115379_1123115394 26 Left 1123115379 14:105892045-105892067 CCTCTGTGGGAGGGGCTGCTACC No data
Right 1123115394 14:105892094-105892116 CACTGAGGGGCTTTTGGGTCTGG No data
1123115387_1123115394 -1 Left 1123115387 14:105892072-105892094 CCCAGGACTGCAGTGGAGGGCTC No data
Right 1123115394 14:105892094-105892116 CACTGAGGGGCTTTTGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123115394 Original CRISPR CACTGAGGGGCTTTTGGGTC TGG Intergenic