ID: 1123115395

View in Genome Browser
Species Human (GRCh38)
Location 14:105892109-105892131
Sequence GGGTCTGGCCTGAGCCGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123115387_1123115395 14 Left 1123115387 14:105892072-105892094 CCCAGGACTGCAGTGGAGGGCTC No data
Right 1123115395 14:105892109-105892131 GGGTCTGGCCTGAGCCGCTGTGG No data
1123115384_1123115395 19 Left 1123115384 14:105892067-105892089 CCAGGCCCAGGACTGCAGTGGAG No data
Right 1123115395 14:105892109-105892131 GGGTCTGGCCTGAGCCGCTGTGG No data
1123115388_1123115395 13 Left 1123115388 14:105892073-105892095 CCAGGACTGCAGTGGAGGGCTCA No data
Right 1123115395 14:105892109-105892131 GGGTCTGGCCTGAGCCGCTGTGG No data
1123115383_1123115395 20 Left 1123115383 14:105892066-105892088 CCCAGGCCCAGGACTGCAGTGGA No data
Right 1123115395 14:105892109-105892131 GGGTCTGGCCTGAGCCGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123115395 Original CRISPR GGGTCTGGCCTGAGCCGCTG TGG Intergenic