ID: 1123115507

View in Genome Browser
Species Human (GRCh38)
Location 14:105892489-105892511
Sequence CAGGCTGCGGGGAAGGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123115507_1123115517 -4 Left 1123115507 14:105892489-105892511 CCCTGGTCCTTCCCCGCAGCCTG No data
Right 1123115517 14:105892508-105892530 CCTGCCACGGTGGGAGCCCCAGG No data
1123115507_1123115520 1 Left 1123115507 14:105892489-105892511 CCCTGGTCCTTCCCCGCAGCCTG No data
Right 1123115520 14:105892513-105892535 CACGGTGGGAGCCCCAGGCAGGG No data
1123115507_1123115525 19 Left 1123115507 14:105892489-105892511 CCCTGGTCCTTCCCCGCAGCCTG No data
Right 1123115525 14:105892531-105892553 CAGGGTGGACCATACCCTCTAGG No data
1123115507_1123115527 26 Left 1123115507 14:105892489-105892511 CCCTGGTCCTTCCCCGCAGCCTG No data
Right 1123115527 14:105892538-105892560 GACCATACCCTCTAGGAGGCTGG No data
1123115507_1123115526 22 Left 1123115507 14:105892489-105892511 CCCTGGTCCTTCCCCGCAGCCTG No data
Right 1123115526 14:105892534-105892556 GGTGGACCATACCCTCTAGGAGG No data
1123115507_1123115519 0 Left 1123115507 14:105892489-105892511 CCCTGGTCCTTCCCCGCAGCCTG No data
Right 1123115519 14:105892512-105892534 CCACGGTGGGAGCCCCAGGCAGG No data
1123115507_1123115521 4 Left 1123115507 14:105892489-105892511 CCCTGGTCCTTCCCCGCAGCCTG No data
Right 1123115521 14:105892516-105892538 GGTGGGAGCCCCAGGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123115507 Original CRISPR CAGGCTGCGGGGAAGGACCA GGG (reversed) Intergenic
No off target data available for this crispr