ID: 1123115556

View in Genome Browser
Species Human (GRCh38)
Location 14:105892644-105892666
Sequence CATGGGAATCCGGTATCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123115556_1123115576 27 Left 1123115556 14:105892644-105892666 CCTGGGGATACCGGATTCCCATG No data
Right 1123115576 14:105892694-105892716 GAGGGGCAGGGCTGGGTCCTGGG No data
1123115556_1123115565 1 Left 1123115556 14:105892644-105892666 CCTGGGGATACCGGATTCCCATG No data
Right 1123115565 14:105892668-105892690 GGTGATGAGAGGAGAGCAGAGGG No data
1123115556_1123115571 14 Left 1123115556 14:105892644-105892666 CCTGGGGATACCGGATTCCCATG No data
Right 1123115571 14:105892681-105892703 GAGCAGAGGGGAGGAGGGGCAGG No data
1123115556_1123115572 15 Left 1123115556 14:105892644-105892666 CCTGGGGATACCGGATTCCCATG No data
Right 1123115572 14:105892682-105892704 AGCAGAGGGGAGGAGGGGCAGGG No data
1123115556_1123115564 0 Left 1123115556 14:105892644-105892666 CCTGGGGATACCGGATTCCCATG No data
Right 1123115564 14:105892667-105892689 GGGTGATGAGAGGAGAGCAGAGG No data
1123115556_1123115575 26 Left 1123115556 14:105892644-105892666 CCTGGGGATACCGGATTCCCATG No data
Right 1123115575 14:105892693-105892715 GGAGGGGCAGGGCTGGGTCCTGG No data
1123115556_1123115573 19 Left 1123115556 14:105892644-105892666 CCTGGGGATACCGGATTCCCATG No data
Right 1123115573 14:105892686-105892708 GAGGGGAGGAGGGGCAGGGCTGG No data
1123115556_1123115566 2 Left 1123115556 14:105892644-105892666 CCTGGGGATACCGGATTCCCATG No data
Right 1123115566 14:105892669-105892691 GTGATGAGAGGAGAGCAGAGGGG No data
1123115556_1123115568 8 Left 1123115556 14:105892644-105892666 CCTGGGGATACCGGATTCCCATG No data
Right 1123115568 14:105892675-105892697 AGAGGAGAGCAGAGGGGAGGAGG No data
1123115556_1123115569 9 Left 1123115556 14:105892644-105892666 CCTGGGGATACCGGATTCCCATG No data
Right 1123115569 14:105892676-105892698 GAGGAGAGCAGAGGGGAGGAGGG No data
1123115556_1123115570 10 Left 1123115556 14:105892644-105892666 CCTGGGGATACCGGATTCCCATG No data
Right 1123115570 14:105892677-105892699 AGGAGAGCAGAGGGGAGGAGGGG No data
1123115556_1123115567 5 Left 1123115556 14:105892644-105892666 CCTGGGGATACCGGATTCCCATG No data
Right 1123115567 14:105892672-105892694 ATGAGAGGAGAGCAGAGGGGAGG No data
1123115556_1123115561 -10 Left 1123115556 14:105892644-105892666 CCTGGGGATACCGGATTCCCATG No data
Right 1123115561 14:105892657-105892679 GATTCCCATGGGGTGATGAGAGG No data
1123115556_1123115574 20 Left 1123115556 14:105892644-105892666 CCTGGGGATACCGGATTCCCATG No data
Right 1123115574 14:105892687-105892709 AGGGGAGGAGGGGCAGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123115556 Original CRISPR CATGGGAATCCGGTATCCCC AGG (reversed) Intergenic
No off target data available for this crispr