ID: 1123116984

View in Genome Browser
Species Human (GRCh38)
Location 14:105899300-105899322
Sequence ACACAGAACAACCCCAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123116984_1123116992 14 Left 1123116984 14:105899300-105899322 CCTGGTTTGGGGTTGTTCTGTGT No data
Right 1123116992 14:105899337-105899359 GGCCTGTGTGTAAGTGGACGGGG No data
1123116984_1123116993 15 Left 1123116984 14:105899300-105899322 CCTGGTTTGGGGTTGTTCTGTGT No data
Right 1123116993 14:105899338-105899360 GCCTGTGTGTAAGTGGACGGGGG No data
1123116984_1123116988 8 Left 1123116984 14:105899300-105899322 CCTGGTTTGGGGTTGTTCTGTGT No data
Right 1123116988 14:105899331-105899353 CTTCCTGGCCTGTGTGTAAGTGG No data
1123116984_1123116997 27 Left 1123116984 14:105899300-105899322 CCTGGTTTGGGGTTGTTCTGTGT No data
Right 1123116997 14:105899350-105899372 GTGGACGGGGGAGGGCGCCCAGG No data
1123116984_1123116987 -7 Left 1123116984 14:105899300-105899322 CCTGGTTTGGGGTTGTTCTGTGT No data
Right 1123116987 14:105899316-105899338 TCTGTGTGGGAACAGCTTCCTGG No data
1123116984_1123116990 12 Left 1123116984 14:105899300-105899322 CCTGGTTTGGGGTTGTTCTGTGT No data
Right 1123116990 14:105899335-105899357 CTGGCCTGTGTGTAAGTGGACGG No data
1123116984_1123116991 13 Left 1123116984 14:105899300-105899322 CCTGGTTTGGGGTTGTTCTGTGT No data
Right 1123116991 14:105899336-105899358 TGGCCTGTGTGTAAGTGGACGGG No data
1123116984_1123116996 19 Left 1123116984 14:105899300-105899322 CCTGGTTTGGGGTTGTTCTGTGT No data
Right 1123116996 14:105899342-105899364 GTGTGTAAGTGGACGGGGGAGGG No data
1123116984_1123116995 18 Left 1123116984 14:105899300-105899322 CCTGGTTTGGGGTTGTTCTGTGT No data
Right 1123116995 14:105899341-105899363 TGTGTGTAAGTGGACGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123116984 Original CRISPR ACACAGAACAACCCCAAACC AGG (reversed) Intergenic
No off target data available for this crispr