ID: 1123116996

View in Genome Browser
Species Human (GRCh38)
Location 14:105899342-105899364
Sequence GTGTGTAAGTGGACGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123116984_1123116996 19 Left 1123116984 14:105899300-105899322 CCTGGTTTGGGGTTGTTCTGTGT No data
Right 1123116996 14:105899342-105899364 GTGTGTAAGTGGACGGGGGAGGG No data
1123116983_1123116996 28 Left 1123116983 14:105899291-105899313 CCAGGCGGTCCTGGTTTGGGGTT No data
Right 1123116996 14:105899342-105899364 GTGTGTAAGTGGACGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123116996 Original CRISPR GTGTGTAAGTGGACGGGGGA GGG Intergenic
No off target data available for this crispr