ID: 1123117380

View in Genome Browser
Species Human (GRCh38)
Location 14:105900816-105900838
Sequence GTGCAGGCCTCGGTCTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123117380_1123117385 -2 Left 1123117380 14:105900816-105900838 CCCACAGAGACCGAGGCCTGCAC No data
Right 1123117385 14:105900837-105900859 ACACATTCCGCCCCGGTGTGTGG No data
1123117380_1123117388 3 Left 1123117380 14:105900816-105900838 CCCACAGAGACCGAGGCCTGCAC No data
Right 1123117388 14:105900842-105900864 TTCCGCCCCGGTGTGTGGGGTGG No data
1123117380_1123117394 10 Left 1123117380 14:105900816-105900838 CCCACAGAGACCGAGGCCTGCAC No data
Right 1123117394 14:105900849-105900871 CCGGTGTGTGGGGTGGGCCCAGG No data
1123117380_1123117389 4 Left 1123117380 14:105900816-105900838 CCCACAGAGACCGAGGCCTGCAC No data
Right 1123117389 14:105900843-105900865 TCCGCCCCGGTGTGTGGGGTGGG No data
1123117380_1123117397 24 Left 1123117380 14:105900816-105900838 CCCACAGAGACCGAGGCCTGCAC No data
Right 1123117397 14:105900863-105900885 GGGCCCAGGACTCTCTGGGCAGG No data
1123117380_1123117396 20 Left 1123117380 14:105900816-105900838 CCCACAGAGACCGAGGCCTGCAC No data
Right 1123117396 14:105900859-105900881 GGGTGGGCCCAGGACTCTCTGGG No data
1123117380_1123117386 -1 Left 1123117380 14:105900816-105900838 CCCACAGAGACCGAGGCCTGCAC No data
Right 1123117386 14:105900838-105900860 CACATTCCGCCCCGGTGTGTGGG No data
1123117380_1123117383 -9 Left 1123117380 14:105900816-105900838 CCCACAGAGACCGAGGCCTGCAC No data
Right 1123117383 14:105900830-105900852 GGCCTGCACACATTCCGCCCCGG No data
1123117380_1123117395 19 Left 1123117380 14:105900816-105900838 CCCACAGAGACCGAGGCCTGCAC No data
Right 1123117395 14:105900858-105900880 GGGGTGGGCCCAGGACTCTCTGG No data
1123117380_1123117387 0 Left 1123117380 14:105900816-105900838 CCCACAGAGACCGAGGCCTGCAC No data
Right 1123117387 14:105900839-105900861 ACATTCCGCCCCGGTGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123117380 Original CRISPR GTGCAGGCCTCGGTCTCTGT GGG (reversed) Intergenic
No off target data available for this crispr