ID: 1123117382

View in Genome Browser
Species Human (GRCh38)
Location 14:105900826-105900848
Sequence GGCGGAATGTGTGCAGGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123117382_1123117387 -10 Left 1123117382 14:105900826-105900848 CCGAGGCCTGCACACATTCCGCC No data
Right 1123117387 14:105900839-105900861 ACATTCCGCCCCGGTGTGTGGGG No data
1123117382_1123117394 0 Left 1123117382 14:105900826-105900848 CCGAGGCCTGCACACATTCCGCC No data
Right 1123117394 14:105900849-105900871 CCGGTGTGTGGGGTGGGCCCAGG No data
1123117382_1123117395 9 Left 1123117382 14:105900826-105900848 CCGAGGCCTGCACACATTCCGCC No data
Right 1123117395 14:105900858-105900880 GGGGTGGGCCCAGGACTCTCTGG No data
1123117382_1123117397 14 Left 1123117382 14:105900826-105900848 CCGAGGCCTGCACACATTCCGCC No data
Right 1123117397 14:105900863-105900885 GGGCCCAGGACTCTCTGGGCAGG No data
1123117382_1123117400 27 Left 1123117382 14:105900826-105900848 CCGAGGCCTGCACACATTCCGCC No data
Right 1123117400 14:105900876-105900898 TCTGGGCAGGTCAGCCTCAATGG No data
1123117382_1123117388 -7 Left 1123117382 14:105900826-105900848 CCGAGGCCTGCACACATTCCGCC No data
Right 1123117388 14:105900842-105900864 TTCCGCCCCGGTGTGTGGGGTGG No data
1123117382_1123117402 29 Left 1123117382 14:105900826-105900848 CCGAGGCCTGCACACATTCCGCC No data
Right 1123117402 14:105900878-105900900 TGGGCAGGTCAGCCTCAATGGGG No data
1123117382_1123117396 10 Left 1123117382 14:105900826-105900848 CCGAGGCCTGCACACATTCCGCC No data
Right 1123117396 14:105900859-105900881 GGGTGGGCCCAGGACTCTCTGGG No data
1123117382_1123117401 28 Left 1123117382 14:105900826-105900848 CCGAGGCCTGCACACATTCCGCC No data
Right 1123117401 14:105900877-105900899 CTGGGCAGGTCAGCCTCAATGGG No data
1123117382_1123117389 -6 Left 1123117382 14:105900826-105900848 CCGAGGCCTGCACACATTCCGCC No data
Right 1123117389 14:105900843-105900865 TCCGCCCCGGTGTGTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123117382 Original CRISPR GGCGGAATGTGTGCAGGCCT CGG (reversed) Intergenic
No off target data available for this crispr