ID: 1123117384

View in Genome Browser
Species Human (GRCh38)
Location 14:105900832-105900854
Sequence CACCGGGGCGGAATGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123117384_1123117400 21 Left 1123117384 14:105900832-105900854 CCTGCACACATTCCGCCCCGGTG No data
Right 1123117400 14:105900876-105900898 TCTGGGCAGGTCAGCCTCAATGG No data
1123117384_1123117402 23 Left 1123117384 14:105900832-105900854 CCTGCACACATTCCGCCCCGGTG No data
Right 1123117402 14:105900878-105900900 TGGGCAGGTCAGCCTCAATGGGG No data
1123117384_1123117394 -6 Left 1123117384 14:105900832-105900854 CCTGCACACATTCCGCCCCGGTG No data
Right 1123117394 14:105900849-105900871 CCGGTGTGTGGGGTGGGCCCAGG No data
1123117384_1123117401 22 Left 1123117384 14:105900832-105900854 CCTGCACACATTCCGCCCCGGTG No data
Right 1123117401 14:105900877-105900899 CTGGGCAGGTCAGCCTCAATGGG No data
1123117384_1123117397 8 Left 1123117384 14:105900832-105900854 CCTGCACACATTCCGCCCCGGTG No data
Right 1123117397 14:105900863-105900885 GGGCCCAGGACTCTCTGGGCAGG No data
1123117384_1123117395 3 Left 1123117384 14:105900832-105900854 CCTGCACACATTCCGCCCCGGTG No data
Right 1123117395 14:105900858-105900880 GGGGTGGGCCCAGGACTCTCTGG No data
1123117384_1123117396 4 Left 1123117384 14:105900832-105900854 CCTGCACACATTCCGCCCCGGTG No data
Right 1123117396 14:105900859-105900881 GGGTGGGCCCAGGACTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123117384 Original CRISPR CACCGGGGCGGAATGTGTGC AGG (reversed) Intergenic
No off target data available for this crispr