ID: 1123117390

View in Genome Browser
Species Human (GRCh38)
Location 14:105900844-105900866
Sequence GCCCACCCCACACACCGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123117390_1123117395 -9 Left 1123117390 14:105900844-105900866 CCGCCCCGGTGTGTGGGGTGGGC No data
Right 1123117395 14:105900858-105900880 GGGGTGGGCCCAGGACTCTCTGG No data
1123117390_1123117403 22 Left 1123117390 14:105900844-105900866 CCGCCCCGGTGTGTGGGGTGGGC No data
Right 1123117403 14:105900889-105900911 GCCTCAATGGGGAGAGTGCTCGG No data
1123117390_1123117400 9 Left 1123117390 14:105900844-105900866 CCGCCCCGGTGTGTGGGGTGGGC No data
Right 1123117400 14:105900876-105900898 TCTGGGCAGGTCAGCCTCAATGG No data
1123117390_1123117397 -4 Left 1123117390 14:105900844-105900866 CCGCCCCGGTGTGTGGGGTGGGC No data
Right 1123117397 14:105900863-105900885 GGGCCCAGGACTCTCTGGGCAGG No data
1123117390_1123117402 11 Left 1123117390 14:105900844-105900866 CCGCCCCGGTGTGTGGGGTGGGC No data
Right 1123117402 14:105900878-105900900 TGGGCAGGTCAGCCTCAATGGGG No data
1123117390_1123117401 10 Left 1123117390 14:105900844-105900866 CCGCCCCGGTGTGTGGGGTGGGC No data
Right 1123117401 14:105900877-105900899 CTGGGCAGGTCAGCCTCAATGGG No data
1123117390_1123117396 -8 Left 1123117390 14:105900844-105900866 CCGCCCCGGTGTGTGGGGTGGGC No data
Right 1123117396 14:105900859-105900881 GGGTGGGCCCAGGACTCTCTGGG No data
1123117390_1123117405 23 Left 1123117390 14:105900844-105900866 CCGCCCCGGTGTGTGGGGTGGGC No data
Right 1123117405 14:105900890-105900912 CCTCAATGGGGAGAGTGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123117390 Original CRISPR GCCCACCCCACACACCGGGG CGG (reversed) Intergenic
No off target data available for this crispr