ID: 1123117396

View in Genome Browser
Species Human (GRCh38)
Location 14:105900859-105900881
Sequence GGGTGGGCCCAGGACTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123117381_1123117396 19 Left 1123117381 14:105900817-105900839 CCACAGAGACCGAGGCCTGCACA No data
Right 1123117396 14:105900859-105900881 GGGTGGGCCCAGGACTCTCTGGG No data
1123117382_1123117396 10 Left 1123117382 14:105900826-105900848 CCGAGGCCTGCACACATTCCGCC No data
Right 1123117396 14:105900859-105900881 GGGTGGGCCCAGGACTCTCTGGG No data
1123117390_1123117396 -8 Left 1123117390 14:105900844-105900866 CCGCCCCGGTGTGTGGGGTGGGC No data
Right 1123117396 14:105900859-105900881 GGGTGGGCCCAGGACTCTCTGGG No data
1123117380_1123117396 20 Left 1123117380 14:105900816-105900838 CCCACAGAGACCGAGGCCTGCAC No data
Right 1123117396 14:105900859-105900881 GGGTGGGCCCAGGACTCTCTGGG No data
1123117384_1123117396 4 Left 1123117384 14:105900832-105900854 CCTGCACACATTCCGCCCCGGTG No data
Right 1123117396 14:105900859-105900881 GGGTGGGCCCAGGACTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123117396 Original CRISPR GGGTGGGCCCAGGACTCTCT GGG Intergenic
No off target data available for this crispr