ID: 1123117509

View in Genome Browser
Species Human (GRCh38)
Location 14:105901341-105901363
Sequence GTCTCCAGCCTCTGCAGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123117509_1123117520 14 Left 1123117509 14:105901341-105901363 CCCGACCTGCAGAGGCTGGAGAC No data
Right 1123117520 14:105901378-105901400 GGGTGTGGGCTGGGTGGTCCTGG No data
1123117509_1123117512 -7 Left 1123117509 14:105901341-105901363 CCCGACCTGCAGAGGCTGGAGAC No data
Right 1123117512 14:105901357-105901379 TGGAGACAGACGTTCCTCTCAGG No data
1123117509_1123117515 0 Left 1123117509 14:105901341-105901363 CCCGACCTGCAGAGGCTGGAGAC No data
Right 1123117515 14:105901364-105901386 AGACGTTCCTCTCAGGGTGTGGG No data
1123117509_1123117517 5 Left 1123117509 14:105901341-105901363 CCCGACCTGCAGAGGCTGGAGAC No data
Right 1123117517 14:105901369-105901391 TTCCTCTCAGGGTGTGGGCTGGG No data
1123117509_1123117521 18 Left 1123117509 14:105901341-105901363 CCCGACCTGCAGAGGCTGGAGAC No data
Right 1123117521 14:105901382-105901404 GTGGGCTGGGTGGTCCTGGATGG No data
1123117509_1123117519 8 Left 1123117509 14:105901341-105901363 CCCGACCTGCAGAGGCTGGAGAC No data
Right 1123117519 14:105901372-105901394 CTCTCAGGGTGTGGGCTGGGTGG No data
1123117509_1123117513 -6 Left 1123117509 14:105901341-105901363 CCCGACCTGCAGAGGCTGGAGAC No data
Right 1123117513 14:105901358-105901380 GGAGACAGACGTTCCTCTCAGGG No data
1123117509_1123117514 -1 Left 1123117509 14:105901341-105901363 CCCGACCTGCAGAGGCTGGAGAC No data
Right 1123117514 14:105901363-105901385 CAGACGTTCCTCTCAGGGTGTGG No data
1123117509_1123117516 4 Left 1123117509 14:105901341-105901363 CCCGACCTGCAGAGGCTGGAGAC No data
Right 1123117516 14:105901368-105901390 GTTCCTCTCAGGGTGTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123117509 Original CRISPR GTCTCCAGCCTCTGCAGGTC GGG (reversed) Intergenic
No off target data available for this crispr