ID: 1123118442

View in Genome Browser
Species Human (GRCh38)
Location 14:105905301-105905323
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123118442_1123118453 29 Left 1123118442 14:105905301-105905323 CCAAGGCCAGGTGAGTTCCAGGA No data
Right 1123118453 14:105905353-105905375 GGTGAGTTGAGGCCCAGGTCAGG No data
1123118442_1123118448 8 Left 1123118442 14:105905301-105905323 CCAAGGCCAGGTGAGTTCCAGGA No data
Right 1123118448 14:105905332-105905354 ACCCAGGTCAGGAGACGTTCAGG No data
1123118442_1123118452 24 Left 1123118442 14:105905301-105905323 CCAAGGCCAGGTGAGTTCCAGGA No data
Right 1123118452 14:105905348-105905370 GTTCAGGTGAGTTGAGGCCCAGG No data
1123118442_1123118447 -3 Left 1123118442 14:105905301-105905323 CCAAGGCCAGGTGAGTTCCAGGA No data
Right 1123118447 14:105905321-105905343 GGACAGGTTAAACCCAGGTCAGG No data
1123118442_1123118445 -8 Left 1123118442 14:105905301-105905323 CCAAGGCCAGGTGAGTTCCAGGA No data
Right 1123118445 14:105905316-105905338 TTCCAGGACAGGTTAAACCCAGG No data
1123118442_1123118451 18 Left 1123118442 14:105905301-105905323 CCAAGGCCAGGTGAGTTCCAGGA No data
Right 1123118451 14:105905342-105905364 GGAGACGTTCAGGTGAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123118442 Original CRISPR TCCTGGAACTCACCTGGCCT TGG (reversed) Intergenic
No off target data available for this crispr