ID: 1123118446

View in Genome Browser
Species Human (GRCh38)
Location 14:105905318-105905340
Sequence GACCTGGGTTTAACCTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123118446_1123118458 28 Left 1123118446 14:105905318-105905340 CCAGGACAGGTTAAACCCAGGTC No data
Right 1123118458 14:105905369-105905391 GGTCAGGTAAAGCTTGGGACAGG No data
1123118446_1123118454 22 Left 1123118446 14:105905318-105905340 CCAGGACAGGTTAAACCCAGGTC No data
Right 1123118454 14:105905363-105905385 GGCCCAGGTCAGGTAAAGCTTGG No data
1123118446_1123118455 23 Left 1123118446 14:105905318-105905340 CCAGGACAGGTTAAACCCAGGTC No data
Right 1123118455 14:105905364-105905386 GCCCAGGTCAGGTAAAGCTTGGG No data
1123118446_1123118451 1 Left 1123118446 14:105905318-105905340 CCAGGACAGGTTAAACCCAGGTC No data
Right 1123118451 14:105905342-105905364 GGAGACGTTCAGGTGAGTTGAGG No data
1123118446_1123118453 12 Left 1123118446 14:105905318-105905340 CCAGGACAGGTTAAACCCAGGTC No data
Right 1123118453 14:105905353-105905375 GGTGAGTTGAGGCCCAGGTCAGG No data
1123118446_1123118452 7 Left 1123118446 14:105905318-105905340 CCAGGACAGGTTAAACCCAGGTC No data
Right 1123118452 14:105905348-105905370 GTTCAGGTGAGTTGAGGCCCAGG No data
1123118446_1123118448 -9 Left 1123118446 14:105905318-105905340 CCAGGACAGGTTAAACCCAGGTC No data
Right 1123118448 14:105905332-105905354 ACCCAGGTCAGGAGACGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123118446 Original CRISPR GACCTGGGTTTAACCTGTCC TGG (reversed) Intergenic