ID: 1123118447

View in Genome Browser
Species Human (GRCh38)
Location 14:105905321-105905343
Sequence GGACAGGTTAAACCCAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123118432_1123118447 29 Left 1123118432 14:105905269-105905291 CCCAGGCCAGATGAGGTCCAGGT No data
Right 1123118447 14:105905321-105905343 GGACAGGTTAAACCCAGGTCAGG No data
1123118439_1123118447 12 Left 1123118439 14:105905286-105905308 CCAGGTCAGGGGAAGCCAAGGCC No data
Right 1123118447 14:105905321-105905343 GGACAGGTTAAACCCAGGTCAGG No data
1123118442_1123118447 -3 Left 1123118442 14:105905301-105905323 CCAAGGCCAGGTGAGTTCCAGGA No data
Right 1123118447 14:105905321-105905343 GGACAGGTTAAACCCAGGTCAGG No data
1123118444_1123118447 -9 Left 1123118444 14:105905307-105905329 CCAGGTGAGTTCCAGGACAGGTT No data
Right 1123118447 14:105905321-105905343 GGACAGGTTAAACCCAGGTCAGG No data
1123118436_1123118447 23 Left 1123118436 14:105905275-105905297 CCAGATGAGGTCCAGGTCAGGGG No data
Right 1123118447 14:105905321-105905343 GGACAGGTTAAACCCAGGTCAGG No data
1123118433_1123118447 28 Left 1123118433 14:105905270-105905292 CCAGGCCAGATGAGGTCCAGGTC No data
Right 1123118447 14:105905321-105905343 GGACAGGTTAAACCCAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123118447 Original CRISPR GGACAGGTTAAACCCAGGTC AGG Intergenic
No off target data available for this crispr