ID: 1123118449

View in Genome Browser
Species Human (GRCh38)
Location 14:105905333-105905355
Sequence ACCTGAACGTCTCCTGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123118449_1123118454 7 Left 1123118449 14:105905333-105905355 CCCAGGTCAGGAGACGTTCAGGT No data
Right 1123118454 14:105905363-105905385 GGCCCAGGTCAGGTAAAGCTTGG No data
1123118449_1123118455 8 Left 1123118449 14:105905333-105905355 CCCAGGTCAGGAGACGTTCAGGT No data
Right 1123118455 14:105905364-105905386 GCCCAGGTCAGGTAAAGCTTGGG No data
1123118449_1123118458 13 Left 1123118449 14:105905333-105905355 CCCAGGTCAGGAGACGTTCAGGT No data
Right 1123118458 14:105905369-105905391 GGTCAGGTAAAGCTTGGGACAGG No data
1123118449_1123118459 18 Left 1123118449 14:105905333-105905355 CCCAGGTCAGGAGACGTTCAGGT No data
Right 1123118459 14:105905374-105905396 GGTAAAGCTTGGGACAGGCGAGG No data
1123118449_1123118452 -8 Left 1123118449 14:105905333-105905355 CCCAGGTCAGGAGACGTTCAGGT No data
Right 1123118452 14:105905348-105905370 GTTCAGGTGAGTTGAGGCCCAGG No data
1123118449_1123118453 -3 Left 1123118449 14:105905333-105905355 CCCAGGTCAGGAGACGTTCAGGT No data
Right 1123118453 14:105905353-105905375 GGTGAGTTGAGGCCCAGGTCAGG No data
1123118449_1123118460 29 Left 1123118449 14:105905333-105905355 CCCAGGTCAGGAGACGTTCAGGT No data
Right 1123118460 14:105905385-105905407 GGACAGGCGAGGTCCAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123118449 Original CRISPR ACCTGAACGTCTCCTGACCT GGG (reversed) Intergenic
No off target data available for this crispr