ID: 1123118451

View in Genome Browser
Species Human (GRCh38)
Location 14:105905342-105905364
Sequence GGAGACGTTCAGGTGAGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123118444_1123118451 12 Left 1123118444 14:105905307-105905329 CCAGGTGAGTTCCAGGACAGGTT No data
Right 1123118451 14:105905342-105905364 GGAGACGTTCAGGTGAGTTGAGG No data
1123118446_1123118451 1 Left 1123118446 14:105905318-105905340 CCAGGACAGGTTAAACCCAGGTC No data
Right 1123118451 14:105905342-105905364 GGAGACGTTCAGGTGAGTTGAGG No data
1123118442_1123118451 18 Left 1123118442 14:105905301-105905323 CCAAGGCCAGGTGAGTTCCAGGA No data
Right 1123118451 14:105905342-105905364 GGAGACGTTCAGGTGAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123118451 Original CRISPR GGAGACGTTCAGGTGAGTTG AGG Intergenic
No off target data available for this crispr