ID: 1123118452

View in Genome Browser
Species Human (GRCh38)
Location 14:105905348-105905370
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123118444_1123118452 18 Left 1123118444 14:105905307-105905329 CCAGGTGAGTTCCAGGACAGGTT No data
Right 1123118452 14:105905348-105905370 GTTCAGGTGAGTTGAGGCCCAGG No data
1123118450_1123118452 -9 Left 1123118450 14:105905334-105905356 CCAGGTCAGGAGACGTTCAGGTG No data
Right 1123118452 14:105905348-105905370 GTTCAGGTGAGTTGAGGCCCAGG No data
1123118449_1123118452 -8 Left 1123118449 14:105905333-105905355 CCCAGGTCAGGAGACGTTCAGGT No data
Right 1123118452 14:105905348-105905370 GTTCAGGTGAGTTGAGGCCCAGG No data
1123118442_1123118452 24 Left 1123118442 14:105905301-105905323 CCAAGGCCAGGTGAGTTCCAGGA No data
Right 1123118452 14:105905348-105905370 GTTCAGGTGAGTTGAGGCCCAGG No data
1123118446_1123118452 7 Left 1123118446 14:105905318-105905340 CCAGGACAGGTTAAACCCAGGTC No data
Right 1123118452 14:105905348-105905370 GTTCAGGTGAGTTGAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123118452 Original CRISPR GTTCAGGTGAGTTGAGGCCC AGG Intergenic
No off target data available for this crispr