ID: 1123118458

View in Genome Browser
Species Human (GRCh38)
Location 14:105905369-105905391
Sequence GGTCAGGTAAAGCTTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123118446_1123118458 28 Left 1123118446 14:105905318-105905340 CCAGGACAGGTTAAACCCAGGTC No data
Right 1123118458 14:105905369-105905391 GGTCAGGTAAAGCTTGGGACAGG No data
1123118449_1123118458 13 Left 1123118449 14:105905333-105905355 CCCAGGTCAGGAGACGTTCAGGT No data
Right 1123118458 14:105905369-105905391 GGTCAGGTAAAGCTTGGGACAGG No data
1123118450_1123118458 12 Left 1123118450 14:105905334-105905356 CCAGGTCAGGAGACGTTCAGGTG No data
Right 1123118458 14:105905369-105905391 GGTCAGGTAAAGCTTGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123118458 Original CRISPR GGTCAGGTAAAGCTTGGGAC AGG Intergenic