ID: 1123118460

View in Genome Browser
Species Human (GRCh38)
Location 14:105905385-105905407
Sequence GGACAGGCGAGGTCCAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123118457_1123118460 -4 Left 1123118457 14:105905366-105905388 CCAGGTCAGGTAAAGCTTGGGAC No data
Right 1123118460 14:105905385-105905407 GGACAGGCGAGGTCCAAGTCAGG No data
1123118456_1123118460 -3 Left 1123118456 14:105905365-105905387 CCCAGGTCAGGTAAAGCTTGGGA No data
Right 1123118460 14:105905385-105905407 GGACAGGCGAGGTCCAAGTCAGG No data
1123118449_1123118460 29 Left 1123118449 14:105905333-105905355 CCCAGGTCAGGAGACGTTCAGGT No data
Right 1123118460 14:105905385-105905407 GGACAGGCGAGGTCCAAGTCAGG No data
1123118450_1123118460 28 Left 1123118450 14:105905334-105905356 CCAGGTCAGGAGACGTTCAGGTG No data
Right 1123118460 14:105905385-105905407 GGACAGGCGAGGTCCAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123118460 Original CRISPR GGACAGGCGAGGTCCAAGTC AGG Intergenic