ID: 1123119023

View in Genome Browser
Species Human (GRCh38)
Location 14:105908509-105908531
Sequence TGCACAGGGTGCTCCCCCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123119019_1123119023 3 Left 1123119019 14:105908483-105908505 CCAGGGTGTGGACTGCAGGGAGG No data
Right 1123119023 14:105908509-105908531 TGCACAGGGTGCTCCCCCGAAGG No data
1123119017_1123119023 5 Left 1123119017 14:105908481-105908503 CCCCAGGGTGTGGACTGCAGGGA No data
Right 1123119023 14:105908509-105908531 TGCACAGGGTGCTCCCCCGAAGG No data
1123119018_1123119023 4 Left 1123119018 14:105908482-105908504 CCCAGGGTGTGGACTGCAGGGAG No data
Right 1123119023 14:105908509-105908531 TGCACAGGGTGCTCCCCCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123119023 Original CRISPR TGCACAGGGTGCTCCCCCGA AGG Intergenic