ID: 1123119060

View in Genome Browser
Species Human (GRCh38)
Location 14:105908650-105908672
Sequence GTGTGTAAGTGGACGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123119048_1123119060 17 Left 1123119048 14:105908610-105908632 CCGTCTGGGGTTGGTCTGTGTGG No data
Right 1123119060 14:105908650-105908672 GTGTGTAAGTGGACGGGGGAGGG No data
1123119044_1123119060 28 Left 1123119044 14:105908599-105908621 CCAGGTGGTCCCCGTCTGGGGTT No data
Right 1123119060 14:105908650-105908672 GTGTGTAAGTGGACGGGGGAGGG No data
1123119047_1123119060 18 Left 1123119047 14:105908609-105908631 CCCGTCTGGGGTTGGTCTGTGTG No data
Right 1123119060 14:105908650-105908672 GTGTGTAAGTGGACGGGGGAGGG No data
1123119046_1123119060 19 Left 1123119046 14:105908608-105908630 CCCCGTCTGGGGTTGGTCTGTGT No data
Right 1123119060 14:105908650-105908672 GTGTGTAAGTGGACGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123119060 Original CRISPR GTGTGTAAGTGGACGGGGGA GGG Intergenic
No off target data available for this crispr