ID: 1123119756

View in Genome Browser
Species Human (GRCh38)
Location 14:105911205-105911227
Sequence CAGGCTGCAGGGAAGGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123119756_1123119770 19 Left 1123119756 14:105911205-105911227 CCCTGGTCCTTCCCTGCAGCCTG No data
Right 1123119770 14:105911247-105911269 CAGGGTGGACCATACCCTCTAGG No data
1123119756_1123119764 -4 Left 1123119756 14:105911205-105911227 CCCTGGTCCTTCCCTGCAGCCTG No data
Right 1123119764 14:105911224-105911246 CCTGCCACTGTGGGAGCCATAGG No data
1123119756_1123119768 4 Left 1123119756 14:105911205-105911227 CCCTGGTCCTTCCCTGCAGCCTG No data
Right 1123119768 14:105911232-105911254 TGTGGGAGCCATAGGCAGGGTGG No data
1123119756_1123119767 1 Left 1123119756 14:105911205-105911227 CCCTGGTCCTTCCCTGCAGCCTG No data
Right 1123119767 14:105911229-105911251 CACTGTGGGAGCCATAGGCAGGG No data
1123119756_1123119772 26 Left 1123119756 14:105911205-105911227 CCCTGGTCCTTCCCTGCAGCCTG No data
Right 1123119772 14:105911254-105911276 GACCATACCCTCTAGGAGGCTGG No data
1123119756_1123119771 22 Left 1123119756 14:105911205-105911227 CCCTGGTCCTTCCCTGCAGCCTG No data
Right 1123119771 14:105911250-105911272 GGTGGACCATACCCTCTAGGAGG No data
1123119756_1123119766 0 Left 1123119756 14:105911205-105911227 CCCTGGTCCTTCCCTGCAGCCTG No data
Right 1123119766 14:105911228-105911250 CCACTGTGGGAGCCATAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123119756 Original CRISPR CAGGCTGCAGGGAAGGACCA GGG (reversed) Intergenic
No off target data available for this crispr