ID: 1123120476

View in Genome Browser
Species Human (GRCh38)
Location 14:105914034-105914056
Sequence CTCCAATACCAGTCCGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123120476_1123120484 14 Left 1123120476 14:105914034-105914056 CCCCATCCGGACTGGTATTGGAG No data
Right 1123120484 14:105914071-105914093 AGACCTGTTGGACTGAGGTCTGG No data
1123120476_1123120487 26 Left 1123120476 14:105914034-105914056 CCCCATCCGGACTGGTATTGGAG No data
Right 1123120487 14:105914083-105914105 CTGAGGTCTGGCTGACCTATGGG No data
1123120476_1123120486 25 Left 1123120476 14:105914034-105914056 CCCCATCCGGACTGGTATTGGAG No data
Right 1123120486 14:105914082-105914104 ACTGAGGTCTGGCTGACCTATGG No data
1123120476_1123120482 2 Left 1123120476 14:105914034-105914056 CCCCATCCGGACTGGTATTGGAG No data
Right 1123120482 14:105914059-105914081 CAGCAGCGATGCAGACCTGTTGG No data
1123120476_1123120483 9 Left 1123120476 14:105914034-105914056 CCCCATCCGGACTGGTATTGGAG No data
Right 1123120483 14:105914066-105914088 GATGCAGACCTGTTGGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123120476 Original CRISPR CTCCAATACCAGTCCGGATG GGG (reversed) Intergenic
No off target data available for this crispr