ID: 1123121279

View in Genome Browser
Species Human (GRCh38)
Location 14:105918201-105918223
Sequence GACCACTTACACACGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 2, 2: 1, 3: 6, 4: 80}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123121279_1123121293 17 Left 1123121279 14:105918201-105918223 CCCTGGCCCGTGTGTAAGTGGTC 0: 1
1: 2
2: 1
3: 6
4: 80
Right 1123121293 14:105918241-105918263 CTGGAGCTACAAGCGGTGGCAGG 0: 3
1: 0
2: 1
3: 4
4: 95
1123121279_1123121291 10 Left 1123121279 14:105918201-105918223 CCCTGGCCCGTGTGTAAGTGGTC 0: 1
1: 2
2: 1
3: 6
4: 80
Right 1123121291 14:105918234-105918256 CGGAGGTCTGGAGCTACAAGCGG 0: 1
1: 2
2: 0
3: 8
4: 91
1123121279_1123121289 -7 Left 1123121279 14:105918201-105918223 CCCTGGCCCGTGTGTAAGTGGTC 0: 1
1: 2
2: 1
3: 6
4: 80
Right 1123121289 14:105918217-105918239 AGTGGTCGGGGGAGGCACGGAGG 0: 1
1: 0
2: 2
3: 27
4: 352
1123121279_1123121294 21 Left 1123121279 14:105918201-105918223 CCCTGGCCCGTGTGTAAGTGGTC 0: 1
1: 2
2: 1
3: 6
4: 80
Right 1123121294 14:105918245-105918267 AGCTACAAGCGGTGGCAGGAAGG 0: 3
1: 0
2: 2
3: 9
4: 113
1123121279_1123121288 -10 Left 1123121279 14:105918201-105918223 CCCTGGCCCGTGTGTAAGTGGTC 0: 1
1: 2
2: 1
3: 6
4: 80
Right 1123121288 14:105918214-105918236 GTAAGTGGTCGGGGGAGGCACGG 0: 1
1: 0
2: 3
3: 19
4: 253
1123121279_1123121290 -2 Left 1123121279 14:105918201-105918223 CCCTGGCCCGTGTGTAAGTGGTC 0: 1
1: 2
2: 1
3: 6
4: 80
Right 1123121290 14:105918222-105918244 TCGGGGGAGGCACGGAGGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 183
1123121279_1123121292 13 Left 1123121279 14:105918201-105918223 CCCTGGCCCGTGTGTAAGTGGTC 0: 1
1: 2
2: 1
3: 6
4: 80
Right 1123121292 14:105918237-105918259 AGGTCTGGAGCTACAAGCGGTGG 0: 3
1: 0
2: 0
3: 12
4: 264
1123121279_1123121295 25 Left 1123121279 14:105918201-105918223 CCCTGGCCCGTGTGTAAGTGGTC 0: 1
1: 2
2: 1
3: 6
4: 80
Right 1123121295 14:105918249-105918271 ACAAGCGGTGGCAGGAAGGCAGG 0: 1
1: 0
2: 2
3: 19
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123121279 Original CRISPR GACCACTTACACACGGGCCA GGG (reversed) Intronic
907266372 1:53264049-53264071 GGCCACTCAGACACAGGCCATGG - Intronic
908438640 1:64131526-64131548 TATCATTTACACAAGGGCCAAGG - Intronic
909260751 1:73486490-73486512 GAACACTTAGACACAGGGCAGGG - Intergenic
911513032 1:98831204-98831226 AACCACTTACATAGGTGCCAAGG + Intergenic
917111257 1:171550655-171550677 GAACACTTGCACACAGGGCAGGG - Intronic
921512980 1:216054796-216054818 GTCCAATTACAGACAGGCCAAGG - Intronic
923968079 1:239166274-239166296 GAACACTTGGACACGGGGCAGGG + Intergenic
1065631160 10:27682596-27682618 GACCATTTTCCCACGGACCAGGG + Intronic
1071893213 10:90035191-90035213 GATCACTTAGACACAGGGCAGGG + Intergenic
1072542974 10:96412563-96412585 GAACACTTCCAAACGGGCCAGGG + Intronic
1074725439 10:116303402-116303424 GAACACTTAGACACAGGGCAGGG - Intergenic
1075674018 10:124283357-124283379 GCCCCCTTACACATGAGCCAAGG - Intergenic
1084220395 11:67674318-67674340 GCCCCCTGACCCACGGGCCATGG + Intronic
1087768818 11:102184650-102184672 GACCACTCACACAAGGCCCATGG - Intronic
1088380392 11:109186475-109186497 GAACACTTGCACACAGGGCAGGG - Intergenic
1088594730 11:111432271-111432293 GATCACTTAAACATGGGCTATGG + Intronic
1090390825 11:126386206-126386228 GACCACTAACACAGGGCACAGGG - Intronic
1095294349 12:40511213-40511235 TAACACTGTCACACGGGCCATGG - Intronic
1096196351 12:49651308-49651330 GATCAGTGACACAGGGGCCAAGG + Intronic
1099543929 12:83951509-83951531 TCCCACTTACAAAAGGGCCAGGG + Intergenic
1103901718 12:124306910-124306932 GACCACATGCACACCGGCCTCGG - Intronic
1105384422 13:19916665-19916687 GACCACTTGGACACAGGGCAGGG + Intergenic
1113567459 13:111327390-111327412 AACAACTTACAGAGGGGCCAGGG + Intronic
1116493250 14:45530870-45530892 GAACACTTACACACGGTTAATGG + Intergenic
1117044876 14:51803345-51803367 GACCACTTGGACACAGGGCAGGG + Intergenic
1123112475 14:105879858-105879880 AACCACTTACACACAAGCCAGGG - Intergenic
1123114817 14:105889924-105889946 CACCACTTACACACAGGCCAGGG - Intergenic
1123121279 14:105918201-105918223 GACCACTTACACACGGGCCAGGG - Intronic
1123404005 15:20009865-20009887 GACCACTTACACATGGGCCAGGG - Intergenic
1123513344 15:21016511-21016533 GACCACTTACACATGGGCCAGGG - Intergenic
1127457239 15:59166192-59166214 GACCACCTTCACCCAGGCCAGGG + Intronic
1127849137 15:62897822-62897844 GACCACAGACACGCGGGGCAGGG - Intergenic
1136553105 16:30992176-30992198 GCCCAGGTACACACAGGCCATGG - Exonic
1142034740 16:87856014-87856036 TCCCACTTACAGACAGGCCAAGG - Intronic
1142190511 16:88715125-88715147 GGCCCCTTACCCACGCGCCACGG - Intronic
1145407515 17:22617813-22617835 GAACACTTAGACACAGGGCAGGG + Intergenic
1146659232 17:34653413-34653435 GACCCCTTACACACCATCCAGGG + Intergenic
1152253383 17:79223487-79223509 GACCACTTCCACACATGCCCTGG + Intronic
1157419977 18:47539006-47539028 GATCACTTGGACACGGGGCAGGG - Intergenic
1163578032 19:18122039-18122061 GACCACCACCAGACGGGCCAGGG - Intronic
1164630264 19:29757513-29757535 GACCACTTAGAGATGGCCCAGGG + Intergenic
1167468966 19:49664920-49664942 GACCTCCTTCTCACGGGCCACGG + Intronic
932103874 2:68925585-68925607 CTCCACTTACTCATGGGCCAGGG + Intergenic
933074619 2:77907443-77907465 CACCACTCACAAAAGGGCCAGGG + Intergenic
935398677 2:102637731-102637753 GACCATCTCCTCACGGGCCAGGG - Intronic
1174445275 20:50586904-50586926 GGCCACCTACAAAAGGGCCAAGG - Exonic
1174873373 20:54204099-54204121 GACCAGCTCCACACCGGCCATGG + Intergenic
1175047293 20:56119038-56119060 GATCACATGCACAGGGGCCAGGG + Intergenic
1177071512 21:16514482-16514504 GAACACTTACACACTGGTCATGG - Intergenic
1184362639 22:44027373-44027395 GACCTCTTCCACACTGGCCAGGG - Intronic
951821231 3:26814421-26814443 GAACACATATACACGGGGCAGGG + Intergenic
952305005 3:32137867-32137889 GATCATTTACAGAGGGGCCATGG + Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
954108056 3:48419789-48419811 CACCACTTTCCCAGGGGCCATGG - Exonic
960751649 3:120961461-120961483 GATCACTCACACACGGGGCGGGG - Intronic
962381847 3:134904452-134904474 GACCACAGACACACTGGCCCAGG - Intronic
962645654 3:137436479-137436501 GATCACTTGCACACAGGGCAGGG + Intergenic
968352950 3:198077243-198077265 GACCACTTGCACACGGCCGTGGG + Intergenic
994670398 5:102755617-102755639 GACCCCTCACAAACTGGCCAGGG - Intronic
995235110 5:109820084-109820106 GACCAGTGACACACAGACCACGG - Intronic
997923299 5:138003668-138003690 GACCAGTTCCACGCTGGCCATGG + Intronic
1000238542 5:159387145-159387167 GCCCACTAACACAAGAGCCAAGG - Intergenic
1003041620 6:2693318-2693340 GACAACTTACACAGAGGTCAAGG - Intronic
1013473432 6:110486458-110486480 GAACATTTACTCACGTGCCAGGG - Intergenic
1015290417 6:131532361-131532383 GAACACTTGCACACAGGGCAGGG + Intergenic
1018051159 6:160009560-160009582 AACCCCATACCCACGGGCCAAGG - Intronic
1019426720 7:981207-981229 GATCACTTGAACACGGGCGATGG + Intergenic
1019611435 7:1938805-1938827 GCACACACACACACGGGCCAGGG + Intronic
1019611492 7:1939087-1939109 GCGCACACACACACGGGCCAGGG + Intronic
1019611499 7:1939118-1939140 GCGCACACACACACGGGCCAGGG + Intronic
1021094511 7:16520446-16520468 GAACACTTACACACGGTTGATGG - Intronic
1025139726 7:56452068-56452090 GAACACTTGGACACGGGGCAGGG - Intergenic
1030850563 7:114480211-114480233 GGCCACTTAGACACTTGCCAAGG + Intronic
1032474917 7:132205046-132205068 GACCAATGGCACCCGGGCCAAGG + Intronic
1037595841 8:20353450-20353472 GATCACTTACCCAAGGGCAAAGG - Intergenic
1041253591 8:55959069-55959091 GAACACTTACACACGGTCAATGG - Intronic
1048449507 8:134521299-134521321 AGCCACTTACCCACTGGCCAAGG - Intronic
1052873219 9:33528750-33528772 GACCACTTGCACACGGCCATGGG - Exonic
1053264587 9:36701384-36701406 AACCACCTACACAAGAGCCATGG - Intergenic
1053502881 9:38615999-38616021 GACCACTTGCACACGGCCATGGG + Intergenic
1053564381 9:39232922-39232944 GAACAAATACACACAGGCCATGG + Intronic
1053830164 9:42070823-42070845 GAACAAATACACACAGGCCATGG + Intronic
1054132769 9:61386114-61386136 GAACAAATACACACAGGCCATGG - Intergenic
1054600395 9:67116629-67116651 GAACAAATACACACAGGCCATGG - Intergenic
1057153209 9:92813619-92813641 GACCACTTCCACACGGCCATGGG - Intergenic
1185837903 X:3361997-3362019 GAACACTTACACACTGTTCATGG + Intergenic
1191756779 X:64601636-64601658 GAACACTTGGACACGGGGCAGGG - Intergenic
1195508804 X:105690021-105690043 GATCACTTGGACACGGGTCAGGG + Intronic
1197724648 X:129768430-129768452 GACCACTAACACAGAGGCCCAGG - Exonic
1198587835 X:138142371-138142393 GAACACTTAGACACAGGGCAGGG - Intergenic