ID: 1123122184

View in Genome Browser
Species Human (GRCh38)
Location 14:105921807-105921829
Sequence TCCAGAGCCCCCAAGCATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 2, 2: 0, 3: 22, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123122184_1123122191 14 Left 1123122184 14:105921807-105921829 CCGTGATGCTTGGGGGCTCTGGA 0: 1
1: 2
2: 0
3: 22
4: 165
Right 1123122191 14:105921844-105921866 TGGCCACTCCTGCACTGCCTGGG 0: 3
1: 0
2: 4
3: 20
4: 279
1123122184_1123122190 13 Left 1123122184 14:105921807-105921829 CCGTGATGCTTGGGGGCTCTGGA 0: 1
1: 2
2: 0
3: 22
4: 165
Right 1123122190 14:105921843-105921865 TTGGCCACTCCTGCACTGCCTGG 0: 3
1: 1
2: 2
3: 14
4: 211
1123122184_1123122192 15 Left 1123122184 14:105921807-105921829 CCGTGATGCTTGGGGGCTCTGGA 0: 1
1: 2
2: 0
3: 22
4: 165
Right 1123122192 14:105921845-105921867 GGCCACTCCTGCACTGCCTGGGG 0: 3
1: 0
2: 4
3: 24
4: 333
1123122184_1123122186 -6 Left 1123122184 14:105921807-105921829 CCGTGATGCTTGGGGGCTCTGGA 0: 1
1: 2
2: 0
3: 22
4: 165
Right 1123122186 14:105921824-105921846 TCTGGAGGAAGCCCCAGCTTTGG 0: 3
1: 0
2: 0
3: 23
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123122184 Original CRISPR TCCAGAGCCCCCAAGCATCA CGG (reversed) Intronic
900967564 1:5969482-5969504 TCCAGAGCACCCAACAACCAGGG + Intronic
902251274 1:15155265-15155287 CCCAGAGCCCAGAAGCCTCAGGG + Intronic
902293076 1:15447612-15447634 GCCAGAGGCCCCTATCATCAGGG - Intronic
902851353 1:19160073-19160095 CCCACAGCCACCAAACATCATGG + Intronic
903142548 1:21347647-21347669 TCCAGAGCCCCCCTCCATCATGG + Intergenic
903661654 1:24982264-24982286 CCCAGAGCACACAAGCTTCAGGG + Intergenic
904598979 1:31663493-31663515 TTCAGGGCCCCCACTCATCATGG - Intronic
904601339 1:31674224-31674246 TCCAGAGCCCCCCCTCATCCTGG - Intronic
905179079 1:36155783-36155805 GCCAGAGCCCCCAAACTCCAGGG + Intronic
907482445 1:54754523-54754545 TCCAGGGCCCCCAAGCTACAGGG + Intergenic
909732683 1:78914389-78914411 TCCAGAGCACCCAATTAACACGG + Intronic
911391303 1:97247471-97247493 TCCAAAGCCCTGAAACATCAGGG - Intronic
913974614 1:143445209-143445231 CCCAGATCCCCCAAACATCAGGG - Intergenic
914069004 1:144270825-144270847 CCCAGATCCCCCAAACATCAGGG - Intergenic
914110151 1:144695529-144695551 CCCAGATCCCCCAAACATCAGGG + Intergenic
914918182 1:151830959-151830981 GCCAGAGCCACCAAGCTCCAGGG - Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916194525 1:162210953-162210975 TCCAGAGCCCCCAGGCTTGTGGG - Intronic
918243550 1:182640487-182640509 TCCTGGGTCCTCAAGCATCAGGG - Intergenic
919784614 1:201251348-201251370 TTCTGAGCCCCGAAGCCTCAGGG + Intergenic
920108305 1:203569898-203569920 TCCCGAGTCACCATGCATCAGGG + Intergenic
920664316 1:207950115-207950137 TCCGTAGCCCCCAATCATTATGG - Intergenic
922323849 1:224510679-224510701 ACCTGAGCCCCACAGCATCAAGG - Intronic
1062905014 10:1173963-1173985 TCCACAGCCCCTAAGCATTGCGG - Intergenic
1065976811 10:30849010-30849032 TCCTAGGCCCCCAAGCATCTGGG + Exonic
1067143354 10:43674879-43674901 TCCAGAGCCCCAAAGCATGGTGG - Intergenic
1068487605 10:57679579-57679601 TCCAAAGCCCTCAAAAATCAAGG + Intergenic
1068836957 10:61566467-61566489 TCCAGACCCCTCAAGAATGAAGG - Intergenic
1077543609 11:3159326-3159348 TCCACAGCACCCCAGCCTCAGGG + Intronic
1077614728 11:3666668-3666690 TCCAGACCCTCCAAGCCCCATGG + Intronic
1078363516 11:10688439-10688461 TCCAGAGAGCCCAAGCTTCCTGG - Intronic
1078975943 11:16477047-16477069 TCCAGGACCCCCATGCATTAAGG + Intronic
1081073791 11:38642896-38642918 TCCACTGGCTCCAAGCATCATGG + Intergenic
1084437330 11:69151563-69151585 TTCAGAGCCCTGGAGCATCATGG + Intergenic
1084687425 11:70704760-70704782 TCCAGGGACTCCTAGCATCAAGG - Intronic
1085322863 11:75585342-75585364 CCCAGAGCCCCCAAGAAGCTAGG - Intergenic
1086567963 11:88248612-88248634 TCCAGAGCTCCCAAGCAGATTGG - Intergenic
1088736941 11:112735521-112735543 TCCAGAGCTACCAAGGACCATGG - Intergenic
1089885238 11:121815062-121815084 TCCAGAGCCTTCAATCATCCTGG - Intergenic
1090278969 11:125440000-125440022 TCCAGAATCCGCAAGCACCAGGG + Intergenic
1091603262 12:1930423-1930445 TCCAGAACCCCTTAGCATGATGG + Intergenic
1094221327 12:27996855-27996877 TGCAGAGCCCTCAAGGATCCAGG + Intergenic
1096009016 12:48197519-48197541 TCCAGAGCCCTGAACCTTCACGG - Intergenic
1097961317 12:65534382-65534404 TCCACAGCCCCTAAGCATTTTGG + Intergenic
1101430629 12:104623972-104623994 TCAGGAGCCCCCATTCATCATGG - Intronic
1103449114 12:121015885-121015907 TACAGAGCCCCGCAACATCAAGG - Intronic
1104966561 12:132511112-132511134 TCCAGGGCCCCCAAGCTACAGGG + Intronic
1105861493 13:24419151-24419173 TCCACTGTGCCCAAGCATCATGG + Intergenic
1107472058 13:40700121-40700143 TCCCAACCCCCCAAACATCATGG + Intergenic
1112805498 13:103160215-103160237 TCAAGATCCCCCAAGGACCACGG - Intergenic
1113449486 13:110396990-110397012 TCCTGAGCACCCAGGCTTCACGG + Intronic
1113704568 13:112419309-112419331 TCCAGAGGCCCCAGGCACAAGGG + Intronic
1115002817 14:28442384-28442406 CCAAAAGCCCCGAAGCATCAGGG + Intergenic
1115742769 14:36405633-36405655 TCAAGAGTCCCCAGGCTTCAGGG - Intergenic
1117806826 14:59501738-59501760 TCCAAATCCCCCAAACATTATGG - Intronic
1119226189 14:72946277-72946299 CCCCGAGCCCCCAAGCAGCTGGG - Intronic
1123122184 14:105921807-105921829 TCCAGAGCCCCCAAGCATCACGG - Intronic
1123404848 15:20013372-20013394 TCCAGAGCCACCAAGCATCACGG - Intergenic
1123514179 15:21020020-21020042 TCCAGAGCCACCAAGCATCACGG - Intergenic
1125531797 15:40418412-40418434 ACAACAGCTCCCAAGCATCATGG + Exonic
1126669109 15:51100250-51100272 TCCAGATCCACCTAGCAGCAAGG - Intronic
1128704504 15:69828780-69828802 TCAAGACTCCCCAAGCAACAAGG - Intergenic
1133076860 16:3286453-3286475 TTTAGAGCCCCCCAGCATCCTGG - Intronic
1133416117 16:5608346-5608368 TCCAGAGCTTCCCAGAATCATGG - Intergenic
1133731101 16:8579209-8579231 TCCTGACCTCACAAGCATCATGG - Intronic
1135396114 16:22132836-22132858 CCCAGAGCCCCACAGCTTCAAGG + Intronic
1135826733 16:25735304-25735326 TCCAGAGACTCAAATCATCAGGG + Intronic
1137613704 16:49835166-49835188 TCCAGAGCCCCCACACCCCATGG + Intronic
1141550313 16:84802583-84802605 TCCAGAGCCCCCAACCAAAATGG + Intergenic
1142755847 17:2015943-2015965 TCCAGAGCCTCCAAGCTGGAGGG + Intronic
1143264554 17:5626339-5626361 TCCAGTGGCCGCAAGGATCATGG + Intergenic
1143445345 17:7005992-7006014 CCCAGAGCCGTAAAGCATCATGG - Exonic
1143739426 17:8941761-8941783 TCCACAGGCCGCAAGCAGCAGGG - Intronic
1145917745 17:28585912-28585934 TCCAGAGCCTCAAAGCAGAAAGG - Exonic
1148000891 17:44386217-44386239 TCCAGTGCCCCCATGCCACATGG - Intronic
1148209703 17:45800739-45800761 CCCAGAGCCCCCAGGGGTCAGGG - Intronic
1148837128 17:50471248-50471270 CCTAGAGCCCCCCAGCAGCAGGG + Intronic
1152269165 17:79313703-79313725 GCCACAGCCCCCAAGGATCTGGG - Intronic
1152568535 17:81111160-81111182 GCCAGAGCCCACAAGCTTCCGGG - Intronic
1155281292 18:24242516-24242538 CCCACAGCCCCCAAGGATGAAGG + Intronic
1158510514 18:58086362-58086384 TCCAGAGCCCCCACCCTGCAGGG - Intronic
1159138029 18:64360482-64360504 TCCATAATCCCCATGCATCATGG - Intergenic
1161375369 19:3937114-3937136 GGCAGAGCCCCCACGCCTCAGGG + Intronic
1162148957 19:8631463-8631485 TCCAGACCCCCCAGAGATCAAGG - Intergenic
1163256601 19:16159763-16159785 TCCAGAGCCCTCCACCATCATGG - Intergenic
1163392123 19:17037184-17037206 TACATAGCCCCCAGGCAACAGGG - Intergenic
1163684017 19:18700379-18700401 CCGAGAGCCCCCAAGCACCGTGG - Intronic
1166763404 19:45238535-45238557 CCCAGAGCCCCCAAAGATGAAGG - Intronic
925336047 2:3099981-3100003 TCCAGAGCACACCAACATCAGGG + Intergenic
925618996 2:5772130-5772152 TCCAGGGCCCCTGAGCAGCATGG + Intergenic
926003209 2:9351101-9351123 TACAGTGCCCCCAAGGAGCAGGG - Intronic
927198610 2:20564984-20565006 TCCTGAGCCCCCAAAGAACAGGG - Intronic
928172089 2:29010479-29010501 TCCACAGTCCCCAAGGATCAGGG + Intronic
929068054 2:38000102-38000124 TCCACAGCCTCAAAGCATCTAGG + Intronic
929667245 2:43842515-43842537 GCCAAAGCCCCCAAGCAGGAGGG - Intronic
934179318 2:89606184-89606206 CCCAGATCCCCCAAACATCAGGG - Intergenic
934289604 2:91680447-91680469 CCCAGATCCCCCAAACATCAGGG - Intergenic
935160341 2:100524268-100524290 TCCATACCCCCAAACCATCATGG + Intergenic
935547994 2:104420719-104420741 TCCAGACCATCCTAGCATCATGG - Intergenic
938776997 2:134550813-134550835 TCCAGACGCCCCAGGCATGAGGG - Intronic
940051688 2:149471649-149471671 TCCAGAGCCCCAAACCAGGATGG + Exonic
940921374 2:159311242-159311264 TGCAGAAGCTCCAAGCATCATGG + Intergenic
941005378 2:160241931-160241953 TCCAGGGCACCCAGGCTTCATGG - Intronic
944173311 2:196802322-196802344 TCCTGACTCCCCAAGTATCAAGG - Intergenic
944437491 2:199705942-199705964 CCCAGAGCCCTCAAGAATGAAGG - Intergenic
947837723 2:233187753-233187775 CCCAGAGCCCCCACGACTCAGGG - Intronic
948281172 2:236748970-236748992 TCCAAAGCCCGCATGCTTCAGGG - Intergenic
948872810 2:240812165-240812187 CCCAGAGCCCCAAAGCAACAGGG - Intronic
1170119707 20:12898569-12898591 TTCAGAGCTCCCAAGTCTCATGG + Intergenic
1172629184 20:36366874-36366896 TCCAGAGCACCCTGGCATCCCGG - Intronic
1174059381 20:47821757-47821779 TCCAGATCCCCCAAGGACCCTGG - Intergenic
1175329178 20:58150946-58150968 CACAGAGCCCCCAGGCCTCATGG + Exonic
1175846753 20:62063879-62063901 TCCAGAGTTCCCGAGCCTCAAGG + Intronic
1176004146 20:62850635-62850657 TCCAGTGTCCCCCAGCAGCAGGG + Intronic
1178376011 21:32067933-32067955 TCCAGAGGGCACCAGCATCAGGG + Intergenic
1180247114 21:46555459-46555481 GCCAGGGCCCCAAAGCCTCACGG + Intronic
1180842141 22:18964428-18964450 ACCAGAGCACCCAAGCGGCAAGG + Intergenic
1182042476 22:27249189-27249211 AGCAGAGACCCCAGGCATCAAGG + Intergenic
1182734209 22:32519665-32519687 TCCAAGGCCCCCAACAATCAAGG + Intronic
1183371532 22:37435328-37435350 TCCATGGCCTCCAAGCATGAGGG - Intergenic
1184787785 22:46680185-46680207 TCCAGAACCCCCAGGCAGCCAGG - Intergenic
1184999766 22:48238254-48238276 ACCAGAGCCCCGCAGCGTCAGGG + Intergenic
950405173 3:12799820-12799842 TCCACAGCCCCTAAGCACAATGG - Intronic
950549538 3:13657897-13657919 TCCACAGCCCCAAAGCTCCACGG + Intergenic
951291096 3:20873166-20873188 TCCAGATCCCTCAAGAATGAAGG - Intergenic
952089143 3:29863575-29863597 TACAGATCCCCCAAATATCAGGG + Intronic
952274468 3:31864183-31864205 TCCTGACCCCCCAGGCAGCATGG - Intronic
952973695 3:38674888-38674910 TCCACAGCCACCAAGAACCAAGG - Intergenic
954149382 3:48649900-48649922 TGCAGAGACCTCAAGCAGCAGGG + Intronic
956087670 3:65630222-65630244 TACAGAGCCCCTGAGCAGCAGGG + Intronic
956142787 3:66162456-66162478 TCCAAAGCACCCATGTATCAAGG + Intronic
959401157 3:105903887-105903909 TCCATAATCCCCATGCATCAAGG + Intergenic
960671297 3:120157533-120157555 AACATAGCCCCCAGGCATCAAGG - Intergenic
961306337 3:125960781-125960803 TCCAGGGCCCCCAAGCTACAGGG + Intergenic
961427069 3:126856699-126856721 TTCAGAGCCACCCAGCACCAAGG - Intronic
963923645 3:150929052-150929074 TCCAGAGGCTCCAAGGATCTGGG - Intronic
965258607 3:166449384-166449406 TCCAGAATCCCCAAGTGTCAAGG - Intergenic
967967515 3:194973736-194973758 TCCAGAGCTGCTACGCATCAAGG + Intergenic
968984523 4:3867871-3867893 TCCAGGGGCCCCCAGCATCATGG + Intergenic
969376884 4:6768881-6768903 CCCTGAACCCCAAAGCATCAGGG + Intergenic
969472228 4:7395738-7395760 TCCTGGGCCCCCAAGCATCTTGG + Intronic
969832738 4:9811002-9811024 TTCAGAGCCACCTAGAATCAGGG - Intronic
971489075 4:27192071-27192093 ACCAGAGCCCACTGGCATCATGG + Intergenic
974013485 4:56628048-56628070 TCCACATCCCCCAAGCATTAAGG + Intergenic
976678248 4:87726443-87726465 CCCATAGTCCCCATGCATCATGG + Intergenic
978842655 4:113232982-113233004 TCCAGTGGCCCCAAGCACAAGGG - Intronic
985671812 5:1210683-1210705 ACCAGAGCCCCAAGGCAACAGGG + Intronic
985790693 5:1925572-1925594 CTCAGAGCCCCCAAGGAGCAGGG - Intergenic
986368076 5:7054979-7055001 TGCAGAGCCCACAACCAGCATGG + Intergenic
986706846 5:10459785-10459807 TCCAGAGCACCCTAGAATCCAGG + Intronic
988773863 5:34457867-34457889 TCCAGAGCCCCCAGTTATCTTGG - Intergenic
990477624 5:56176251-56176273 TCCAGAAACCGCATGCATCAAGG + Exonic
990601784 5:57366545-57366567 TCCTGGGCCCCCAGGCATGATGG + Intergenic
994919820 5:106029783-106029805 TGCACAGCCCCCTAACATCAGGG - Intergenic
996907277 5:128615439-128615461 TCCAGAGCCTCTAACCTTCAGGG + Intronic
998955674 5:147435878-147435900 TCCAGGGCCTACCAGCATCAGGG + Intronic
1001251861 5:170152867-170152889 TCCAGATCCTCCCAGCACCACGG + Intergenic
1002617332 5:180464042-180464064 TCCAGAGCCCACAAGGATAACGG - Intergenic
1002933130 6:1647970-1647992 TACAGAGCACCCGAGCATCAGGG - Intronic
1004426087 6:15508029-15508051 GCCGAAGCCCCCAAGCCTCAAGG - Intronic
1005574493 6:27178946-27178968 TCCAGAGACCCCAACCACCAAGG - Intergenic
1006249289 6:32766980-32767002 TCCAGAGCCCACCAGTCTCATGG + Intergenic
1006397474 6:33796637-33796659 CCCTGAGCCCCCAAGCGTCTAGG - Intronic
1007270127 6:40629967-40629989 TCCAGAGCTGCAAAGCAGCAGGG - Intergenic
1007729086 6:43934969-43934991 CCCAGAGCCCCACAGCCTCAGGG - Intergenic
1011032781 6:82941640-82941662 CCCAGAATCCCCATGCATCAGGG + Intronic
1013092002 6:106908502-106908524 TCCAGAGCAAGCAATCATCAGGG + Intergenic
1013665431 6:112342657-112342679 TCCAGAGCTCCCAACCCCCAGGG + Intergenic
1015940444 6:138445987-138446009 TCCATAGCCCACAAGGAGCATGG - Intronic
1018534199 6:164802406-164802428 TCCAGGGACCCCAGACATCATGG - Intergenic
1022501318 7:30883811-30883833 TCCAGAGCCCACACTCATAAAGG - Intronic
1023866514 7:44240998-44241020 TCAAGACCCCTCAAGCCTCAGGG + Intronic
1023996753 7:45163259-45163281 GATAGAGCCCCCAAGCCTCAGGG + Intronic
1024051409 7:45626018-45626040 TCCAGAGCCACCAAGCCTCTAGG - Intronic
1025235519 7:57232226-57232248 TCCAGATCCCCCAAGGACCCTGG + Intergenic
1029673456 7:102049823-102049845 TCCTAAGTCCCCAAACATCAAGG - Intronic
1035725454 8:1822779-1822801 TCCAGAGCACACAAGCCTTAAGG + Intergenic
1036749808 8:11436483-11436505 CCCAGAGACCCCCAGCAGCATGG - Intronic
1038940357 8:32297555-32297577 TCCAGGGTCTCCAAGCATGAAGG + Intronic
1039680510 8:39730448-39730470 TCCAGAGCCCCAGAGCTTCAAGG + Intergenic
1040590582 8:48789002-48789024 TGCAGAGCCGGCAAGCATAAAGG - Intergenic
1043053005 8:75405422-75405444 CCCCGCACCCCCAAGCATCAGGG + Intergenic
1044848443 8:96404882-96404904 TCCTGAGCCCCCATACTTCATGG + Intergenic
1047541244 8:125768620-125768642 TCCAAAGCCACCACCCATCAGGG + Intergenic
1050923113 9:11230542-11230564 TCCAAGCCCCCCAACCATCACGG - Intergenic
1053351053 9:37413431-37413453 TCCATAGCCTCAAGGCATCATGG - Intergenic
1186834805 X:13427133-13427155 TCCAAAGTTCACAAGCATCATGG - Intergenic
1189407979 X:40743045-40743067 TCCAGTGCCTCCAAGTCTCACGG + Intergenic
1192067665 X:67903669-67903691 TCCAGAGCCTGGAAACATCAAGG + Intergenic
1197025545 X:121744585-121744607 TCTGAAGCCCCCAAGAATCAGGG - Intergenic