ID: 1123123414

View in Genome Browser
Species Human (GRCh38)
Location 14:105928547-105928569
Sequence AAGACCGGGGTCCCGGACAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 2, 2: 0, 3: 5, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123123414_1123123421 -5 Left 1123123414 14:105928547-105928569 CCCGTGTCCGGGACCCCGGTCTT 0: 1
1: 2
2: 0
3: 5
4: 51
Right 1123123421 14:105928565-105928587 GTCTTGTGTGGTCCCTGATGTGG 0: 3
1: 0
2: 2
3: 13
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123123414 Original CRISPR AAGACCGGGGTCCCGGACAC GGG (reversed) Intronic
900152109 1:1183222-1183244 CAGGCCGGGGTCACAGACACAGG + Intronic
902896829 1:19485306-19485328 AGGGGCGGGGTCCCGGACCCTGG - Intronic
906365321 1:45205663-45205685 AAGGCCGGGGTCTCGGCCCCAGG + Intronic
914677871 1:149917774-149917796 AGGACGGGGGTCCCGGCCGCGGG + Exonic
915343274 1:155187646-155187668 AAGAGCGGGGACCCAGACACTGG + Intronic
916604906 1:166331445-166331467 AAGACCGAGGTCCAGAGCACAGG - Intergenic
922542968 1:226433118-226433140 AACACTGGGGTCCCGGAGCCTGG + Intergenic
924813955 1:247426656-247426678 AAGACCCAGGTCCTGGTCACAGG + Intronic
1064012039 10:11742867-11742889 CAGGCCCGGGTCCGGGACACGGG - Intronic
1070079976 10:73176386-73176408 GAGACAGGGGTCCCGAACCCCGG - Intronic
1076885273 10:133259208-133259230 AAGACAGGGGCCCGGGACACAGG + Intergenic
1089560264 11:119340096-119340118 GAGACCCGAGTCCCGGACACCGG + Intronic
1090397963 11:126431709-126431731 AAGACCAGGGTGGAGGACACAGG + Intronic
1097640511 12:62175270-62175292 GAAACCTGGGTCCCAGACACAGG + Intronic
1107123374 13:36819320-36819342 AAGCCCGGGGTCGTGGACCCCGG + Exonic
1123123414 14:105928547-105928569 AAGACCGGGGTCCCGGACACGGG - Intronic
1123406058 15:20020051-20020073 AAGACCGGGGTCCCGGACATGGG - Intergenic
1123515388 15:21026699-21026721 AAGACCGGGGTCCCGGACATGGG - Intergenic
1126163603 15:45635292-45635314 AAGACCCGGGTTCCAGACAAGGG - Intronic
1127207277 15:56733653-56733675 AAGACAGGGAGCTCGGACACGGG - Intronic
1132655440 16:1040158-1040180 AAGGCCCGGGTCCCGGGCACAGG - Intergenic
1138134208 16:54507628-54507650 AAGACTGAGGTCCCTGACATGGG - Intergenic
1144761236 17:17708764-17708786 AAGACTGTGGTCCCAGTCACAGG + Intronic
1150675750 17:67245041-67245063 GCGCCCGGGGTCCGGGACACCGG + Intronic
1151700752 17:75741318-75741340 AAGATCAGGGTCTTGGACACTGG - Intronic
1152298313 17:79481178-79481200 GAGACCAGAGGCCCGGACACAGG - Intronic
1163096006 19:15057600-15057622 AAGACCAGGGTACTGGACAGTGG + Exonic
1164886466 19:31782758-31782780 AAAGCCGGGGCCCCGGACAATGG + Intergenic
1166896242 19:46023309-46023331 AGGACCGGGATCCCGGCCCCGGG - Intergenic
1167722406 19:51187496-51187518 AACACCGGGGTCCCTGGGACTGG + Intergenic
931056351 2:58476345-58476367 AAGACCGTGGTTCTGAACACTGG - Intergenic
932574577 2:72955705-72955727 AAGCCCGTGTTCCTGGACACTGG + Intronic
937508966 2:122571057-122571079 AAGAATGGGGTCCCTGCCACGGG - Intergenic
939671003 2:145012439-145012461 AAGACAGGGCTCCAGGACTCGGG - Intergenic
940146672 2:150552575-150552597 AAGAGAGGGGTCCTGGACACAGG + Intergenic
942492765 2:176506438-176506460 AGGACCTGTGTCCTGGACACAGG + Intergenic
947723463 2:232382455-232382477 AAGCCCTGGGTGCAGGACACTGG + Exonic
948178027 2:235959492-235959514 AGGACCGGGTTCCCGTCCACTGG - Intronic
1179496458 21:41774938-41774960 TAGACCGGGGTCAGTGACACTGG - Intergenic
1185365505 22:50434821-50434843 AGGGCCGGGGGCGCGGACACTGG + Intronic
950239434 3:11354867-11354889 AAGACTGTGGTCCCAGACAGAGG + Intronic
954717654 3:52534278-52534300 GAGACCGGGGACCAGGACCCCGG - Intronic
969697458 4:8742769-8742791 AAGACAGGGGTCCCCAACCCCGG - Intergenic
976219726 4:82746776-82746798 AAGAGCGGGGTCCCTGGCAAGGG + Intronic
984759030 4:183348116-183348138 AATATCGGTGTCCCAGACACTGG + Intergenic
986348810 5:6858458-6858480 ACGACCAGGGCCCAGGACACTGG - Intergenic
989115748 5:37950906-37950928 AAGCCCAGGGTCCAGGACAAGGG - Intergenic
999269438 5:150288138-150288160 AAGACTGGGGTCATGCACACAGG - Intronic
1001959558 5:175872002-175872024 ACGGCCGGGGTCCCGGAGCCAGG + Intronic
1002299021 5:178247281-178247303 CAGACTGGGGTCCCGGGCAGAGG + Intronic
1017395170 6:153990509-153990531 AAGGCTGGGATCCAGGACACAGG - Intergenic
1020956520 7:14745724-14745746 AAGAGAGGGGTCCTGCACACAGG - Intronic
1021205369 7:17773586-17773608 AAGACCGGGCTAAGGGACACAGG - Intergenic
1037818799 8:22125692-22125714 AAGTCCCGGGTCCTGGAGACTGG + Exonic
1037879533 8:22566078-22566100 AGGACCGGGGTCGCGGCCGCCGG + Intronic
1048620240 8:136124561-136124583 AAGACCCGGGTGCCAGAAACCGG - Intergenic
1049601269 8:143508816-143508838 CAGTCAGGGGTCCCGGGCACAGG - Intronic
1061735090 9:132649481-132649503 AAGAGCTTGGTCCCCGACACTGG + Intronic
1186514540 X:10156801-10156823 AAACCCGGCGTCCCGGAGACAGG - Intergenic