ID: 1123125452

View in Genome Browser
Species Human (GRCh38)
Location 14:105942865-105942887
Sequence GGGCAAACAGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123125452_1123125459 -2 Left 1123125452 14:105942865-105942887 CCGTCCACCACTGCTGTTTGCCC No data
Right 1123125459 14:105942886-105942908 CCCCGTGGGAGACCCACCGCTGG No data
1123125452_1123125464 13 Left 1123125452 14:105942865-105942887 CCGTCCACCACTGCTGTTTGCCC No data
Right 1123125464 14:105942901-105942923 ACCGCTGGCTTCCATCCCTCCGG No data
1123125452_1123125468 24 Left 1123125452 14:105942865-105942887 CCGTCCACCACTGCTGTTTGCCC No data
Right 1123125468 14:105942912-105942934 CCATCCCTCCGGATCCATCAGGG No data
1123125452_1123125466 23 Left 1123125452 14:105942865-105942887 CCGTCCACCACTGCTGTTTGCCC No data
Right 1123125466 14:105942911-105942933 TCCATCCCTCCGGATCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123125452 Original CRISPR GGGCAAACAGCAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr