ID: 1123125470

View in Genome Browser
Species Human (GRCh38)
Location 14:105942917-105942939
Sequence GGATACCCTGATGGATCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123125470_1123125477 23 Left 1123125470 14:105942917-105942939 CCTCCGGATCCATCAGGGTATCC No data
Right 1123125477 14:105942963-105942985 CGCCCATTGCCACTCTCGATCGG No data
1123125470_1123125474 0 Left 1123125470 14:105942917-105942939 CCTCCGGATCCATCAGGGTATCC No data
Right 1123125474 14:105942940-105942962 GCTGTGCTCCTGATCCAGCGAGG 0: 56
1: 141
2: 116
3: 82
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123125470 Original CRISPR GGATACCCTGATGGATCCGG AGG (reversed) Intergenic
No off target data available for this crispr