ID: 1123130942

View in Genome Browser
Species Human (GRCh38)
Location 14:105984800-105984822
Sequence GAGATGTGCATGGCCTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123130934_1123130942 11 Left 1123130934 14:105984766-105984788 CCATCCATCAAGGATTGCAGCTG No data
Right 1123130942 14:105984800-105984822 GAGATGTGCATGGCCTGCCTGGG No data
1123130932_1123130942 13 Left 1123130932 14:105984764-105984786 CCCCATCCATCAAGGATTGCAGC No data
Right 1123130942 14:105984800-105984822 GAGATGTGCATGGCCTGCCTGGG No data
1123130935_1123130942 7 Left 1123130935 14:105984770-105984792 CCATCAAGGATTGCAGCTGTTGG No data
Right 1123130942 14:105984800-105984822 GAGATGTGCATGGCCTGCCTGGG No data
1123130933_1123130942 12 Left 1123130933 14:105984765-105984787 CCCATCCATCAAGGATTGCAGCT No data
Right 1123130942 14:105984800-105984822 GAGATGTGCATGGCCTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123130942 Original CRISPR GAGATGTGCATGGCCTGCCT GGG Intergenic
No off target data available for this crispr