ID: 1123134182

View in Genome Browser
Species Human (GRCh38)
Location 14:106012106-106012128
Sequence CAGTAGTAACTGGTGGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123134182_1123134194 27 Left 1123134182 14:106012106-106012128 CCCAACTCCACCAGTTACTACTG No data
Right 1123134194 14:106012156-106012178 GTGAGGGACAGGGTCCCCGAAGG No data
1123134182_1123134193 17 Left 1123134182 14:106012106-106012128 CCCAACTCCACCAGTTACTACTG No data
Right 1123134193 14:106012146-106012168 GACAGCGCAGGTGAGGGACAGGG No data
1123134182_1123134190 11 Left 1123134182 14:106012106-106012128 CCCAACTCCACCAGTTACTACTG No data
Right 1123134190 14:106012140-106012162 ACCAGAGACAGCGCAGGTGAGGG No data
1123134182_1123134189 10 Left 1123134182 14:106012106-106012128 CCCAACTCCACCAGTTACTACTG No data
Right 1123134189 14:106012139-106012161 CACCAGAGACAGCGCAGGTGAGG No data
1123134182_1123134192 16 Left 1123134182 14:106012106-106012128 CCCAACTCCACCAGTTACTACTG No data
Right 1123134192 14:106012145-106012167 AGACAGCGCAGGTGAGGGACAGG No data
1123134182_1123134187 5 Left 1123134182 14:106012106-106012128 CCCAACTCCACCAGTTACTACTG No data
Right 1123134187 14:106012134-106012156 GGAGCCACCAGAGACAGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123134182 Original CRISPR CAGTAGTAACTGGTGGAGTT GGG (reversed) Intergenic
No off target data available for this crispr