ID: 1123137049

View in Genome Browser
Species Human (GRCh38)
Location 14:106037817-106037839
Sequence CCTGTTCTGCAGAGGTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123137043_1123137049 9 Left 1123137043 14:106037785-106037807 CCTGGCAGGAAAACGTATCTCAG No data
Right 1123137049 14:106037817-106037839 CCTGTTCTGCAGAGGTGGGGAGG No data
1123137042_1123137049 10 Left 1123137042 14:106037784-106037806 CCCTGGCAGGAAAACGTATCTCA No data
Right 1123137049 14:106037817-106037839 CCTGTTCTGCAGAGGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123137049 Original CRISPR CCTGTTCTGCAGAGGTGGGG AGG Intergenic
No off target data available for this crispr