ID: 1123138960

View in Genome Browser
Species Human (GRCh38)
Location 14:106056458-106056480
Sequence TCTTACCTGGAGTTGGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123138960_1123138965 4 Left 1123138960 14:106056458-106056480 CCCTGAACCAACTCCAGGTAAGA No data
Right 1123138965 14:106056485-106056507 GACATGCCTAGTGTGCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123138960 Original CRISPR TCTTACCTGGAGTTGGTTCA GGG (reversed) Intergenic
No off target data available for this crispr